ZFIN ID: ZDB-TSCRIPT-090929-16983
Transcript Name: os9-202
Previous Name: os9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036506 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036506|OTTDARG00000027222|ZDB-GENE-060929-32 os9|OTTDARP00000029289 os9-001 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 2419 bp
ACCAAATAACAAATCATTTGACAACGCTTGTTTGCGATAT
GAGAGAACTATGGCTTCCTCCTTGATTAAGTGGTTAAGAG
GATTATATGTGTTTTTCTTAACATGTCTCCTGTCTGTCTT
TGCCTTTTTGAATCTAGAAGAATTAAACGAAATGAAATAT
GGCATACAGATTCTCCCCGATCCTGTTATCATGGGACAGA
TGGAAGATGTAATGTTGGTCTCTAACAAATACAAGCAGCT
GTATGAGTGTCGTTTACCAGCTCAGGCAGTGCGTTTCCAT
CAGGACCCGGTGTCAGAGCCTGATGTGCAGGGTTACAGCG
GCCCCGGGGTCCCTGAGCTCCTCAAGCCCATGCAGACGGC
AGCATGTCTGATTAAGACCAAAGACTGGTGGACCTATGAG
TTCTGCTACGGCCAGCACATCAGACAATACCACTTAGAAG
ATTCGGAGATCAAGGGAGATGTACTGTTTTTGGGATATTA
TGATACAGAGTTTGACTGGACGAATGAAACTGCAAAGGCA
TCTAAGCAGCATAAGCTGAAGAGGTATCACAGTCAGTCAT
ATGTCAATGGCTCAAAATGTGACTTAAACGGCAGTCCCAG
AGAGACGGAAGTCAGATTTGTGTGTGAGGAAGGCTCTACT
GACTTCATTTCACGGGTGGATGAACCCCAGTCTTGCCGCT
ACGTCTTGACAGTCCACACCTCTCGCACGTGCCAGCATCC
CCTTCTGCGCCCACCGTCCACTGCCAAACCACAAGGCATT
GTGTGCCAACCTGCTCTCAGTGCCCAGCAGTACATGGACT
ACGTCAAGGCTCAAGTCTCTGACACCAAACGTAAAGTGGA
GCAGATCTCAGAGGAGCTCAGAAACCTGGATGAAATTCTG
TCCAAGGATGACAAGAACAAAGGTGTGCTGGATGACAGAA
CAGATGAGGAACCTGCAGTTAGCTCTGATGAGCCTCCAGT
TTCCAAGGCCCAAAAAAAAGAGGGTGAAGTTGCTGAGAAG
TCGACGAGTGAAGAGCCAGAGGACAAAGACTTCTGGGAAG
GAGTTACCAAACCAGCACACACAAAGCCAAGCACACCTGA
CACAGAGACCCCTCAGGAGCCACAGGACAACCAATTACAT
GAAAATGATTTATTTGGAGAGGAAAAGTTTAACTTTAAAA
TCATCACAGACCCCGCAGACCTCATGAAGTTTGTACAACA
CCTCAGAGAGAGCAACGAAAAGAACAGGAAAGCTGAGCTG
GAAAAAGAAAACCAGCAAGCATCTCAGAAGAGGAAGGAGA
AGGAGGAAAAAATAGAGGAGAAAACAGCAGAGGTGGAGGT
GGAAGTTGAGGATGTAGATGAAGATGAAACATTGCTTCAG
GAGTTTGAGGATGAGATGCAAGATCTATCCGTTCCCTCGT
CCAAGATAGAAGAAATAAAAGAAGAGATGCAGAAAGAGTT
TGACAACATCATAGAGGAAGCTCAGCAGGAGTTAGAAAAT
GAAGGCCTTAAGGGTGAGTTTGATCGTTCTCAGGCTACGC
AAACTCTAGAAAATACACTAGGGAAACTTCTGGACCGTCT
TGAAGACAAGACTGAACATAAGAGTCAAGCAGAAACAGAA
CAAAATGCAGAAATGGATAAAAGCACACATTCACCGCATA
AAACAGAGGGAGGCTCTTCTTCTGGCAACCCAAATCTGGT
TCCCAAAACACCAGCGGACAGCAGCGGCGGCGGCGAGCAG
GTAAAAGTCAGGGTGACTAAGTATAAGGTGGGCGGAGGTG
TGGCTGCAGGAGCGGTTACCGGGGGCAACGATGATGGTGA
TGATGATGAGGGGGGTGTGAAGGTGCAGGAACTGGGCGAG
GGCGACCCCCAGTGGCAGCAGATTCATGAAGTGGTCAAAG
AGCAGCTAGAGAGAGCCGGCATCAAGGCCGAAGGAAAGAT
CGAGGTGAAGATTTTAACCCGTAAAACAGCCGAAGAAGCA
GGAGACCAGTGGCTCTCTGAGGAGGATACGAAATCATTTA
GAGAGCTTCTCATCAACCTTCTGACAGGAGGAACAGAGGA
GGTGTACAAAGAGCAGAAAAGACAGCAAGAGTTGGAAAAC
AATTACAAATTTGTCTGGGGAGAAAAGCAGGATGAGAGTC
AGTCCACAGGAAACAGTGATTCTGACGAAGCAGACTTTTG
AGCCTTTTCCTCATCTCTCAAGCACTGTTATTTTGAAGAA
GGCCAGCCAGCATTCTCTGAACTATAAGCCTGGTAATCAC
TTTACAGTGTGCGTCGCAACCAAACTGCCCTCTCAGACCA
TTCGAGTTCATGTTTAAAAACTTTTGAGGGCTTCAATCCA
CTGCCGGGAATTTTTTCTGTATGAGCGTCTGTGAGTTGTT
TGTAGCTTGTCAGAATATTATGTGGTCGCTTCTTTGAACA
AATATACAAATGCACTTCA

os9 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA os9-002 (1) 1323
os9-003 (1) 834
os9-004 (1) 697
mRNA os9-202 2419
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
os9-202 Contained in:
OTHER os9-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036506 (1)
  • Ensembl_Trans:ENSDART00000133305 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC154126 (1) 2443bp
    GenBank:BC124472 (1) 2364bp
    GenBank:BC095675 (1) 1407bp
    CITATIONS (2)