header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16913
Transcript Name: dcaf7-002
Previous Name: wdr68-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036429 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036429|OTTDARG00000027180|ZDB-GENE-030131-9511 dcaf7|no_translation wdr68-002 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 1040 bp
TTTTCTATCCGGGACTTTTATTTTGAAACGCAGACACACA
TCTTTCAGACCAAATGCGCCGTTGAGCGGTAGGGCCTATT
TAGGGCTTTCTAAAGTTAGAATTAAAACCGTCGGGACTAA
GGAAAAACATGGCCCTTTAGCTACACGCAGTTATGAATGT
TTGATGGTTATTTGCGTGTTTTATTAGGCAGGAATCGTGC
TGTTTTGTAGGCAGCTCGTCGTTTTCGCGGCCGTTGCGGA
GAGGGATTGTTATGACGTTCTCTTTGTCTCGCGCTGCACA
AACCCGAGACCATATTTATCTCTGTAAGAGCCTTTTTTAA
ACATCCCGTCGAATCAAGCTACTCCTAACGACCTAATTCT
CTCTAGCTGTCGCCGATCACTGGGATTGAAGCATGTCGTT
GCACGGTAAACGAAAAGAGATCTACAAATACGAGGCGCCA
TGGACCGTCTATGCTATGAACTGGAGCGTCAGACCCGACA
AGCGCTTTCGGCTCGCGCTCGGCAGCTTCGTCGAGGAGTA
CAACAACAAGGTCCAGCTGGTTGGTCTTGAGGAGGAGAGC
TCAGAGTTTGTATGCAGAAACACTTTTGATCATCCGTACC
CCACCACCAAGATCATGTGGATCCCAGACACCAAAGGCGT
CTATCCAGACCTACTGGCAACCAGTGGAGACTATCTGCGC
ATATGGAGGGTATGCAGGAGGAGCACGTGCACAGTTTCTG
AAGTGCCCCTATTATGCAATATTAAAGTTTGCTCTTTTTG
TTTTGGAGGTCTTCTATAATAAGTTCATCCTAGATCAAGA
ATACACCTGTCATGTCATAATATGCAAAGCAGTATTTTGT
CTTACATGAAGCACCTGAATCAGTCTGTTCAAAGATTCAA
TCTCTCTAAACCCCTTCTTTCCAAGAGTCTACCTTGTTCT
GATTAGTCAAATGGCTTATTCTGTTTACAACAGTGTACTT
TTGAATTTAAATCATATATGACCATATCTGAATTTCAGCT
CTTGTATACACACTGATAAAACAATAGTGTCAGTTCTACC

dcaf7 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA dcaf7-002 1040
mRNA dcaf7-201 (1) 2496
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dcaf7-002 Contained in:

OTHER dcaf7-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036429 (1)
  • Ensembl_Trans:ENSDART00000135046 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH555719 (1) 936 bp
    GenBank:CV117770 (1) 895 bp
    GenBank:EH566433 (1) 864 bp
    GenBank:EH545299 (1) 857 bp
    CITATIONS (2)