ZFIN ID: ZDB-TSCRIPT-090929-16912
Transcript Name: dcaf7-201
Previous Names: dcaf7-001, wdr68-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036428 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036428|OTTDARG00000027180|ZDB-GENE-030131-9511 dcaf7|OTTDARP00000029232 wdr68-001 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 2496 bp
CAGACACACATCTTTCAGACCAAATGCGCCGTTGAGCGGT
AGGGCCTATTTAGGGCTTTCTAAAGTTAGAATTAAAACCG
TCGGGACTAAGGAAAAACATGGCCCTTTAGCTACACGCAG
TTATGAATGTTTGATGGTTATTTGCGTGTTTTATTAGGCA
GGAATCGTGCTGTTTTGTAGGCAGCTCGTCGTTTTCGCGG
CCGTTGCGGAGAGGGATTGTTATGACGTTCTCTTTGTCTC
GCGCTGCACAAACCCGAGACCATATTTATCTCTGTAAGAG
CCTTTTTTAAACATCCCGTCGAATCAAGCTACTCCTAACG
ACCTAATTCTCTCTAGCTGTCGCCGATCACTGGGATTGAA
GCATGTCGTTGCACGGTAAACGAAAAGAGATCTACAAATA
CGAGGCGCCATGGACCGTCTATGCTATGAACTGGAGCGTC
AGACCCGACAAGCGCTTTCGGCTCGCGCTCGGCAGCTTCG
TCGAGGAGTACAACAACAAGGTCCAGCTGGTTGGTCTTGA
GGAGGAGAGCTCAGAGTTTGTATGCAGAAACACTTTTGAT
CATCCGTACCCCACCACCAAGATCATGTGGATCCCAGACA
CCAAAGGCGTCTATCCAGACCTACTGGCAACCAGTGGAGA
CTATCTGCGCATATGGAGGGTGAATGATACAGAGACCCGT
CTGGAGTGTCTGCTGAATAATAATAAGAACTCTGATTTCT
GTGCACCCCTCACCTCATTTGACTGGAATGAAGTGGACCC
CAACCTCCTGGGGACATCTAGTATTGACACCACTTGTACA
ATCTGGGGTCTAGAGACAGGACAGGTCCTGGGAAGAGTCA
ACCTAGTGTCGGGTCACGTCAAAACACAGCTAATTGCTCA
CGACAAGGAGGTGTATGACATCGCATTCAGCCGTGCGGGT
GGAGGTCGGGATATGTTTGCGTCAGTAGGAGCGGATGGGT
CTGTGCGTATGTTTGATTTGCGACACCTGGAGCACAGCAC
CATCATCTATGAGGACCCTCAACACCACCCACTGCTGCGC
CTCTGCTGGAACAAACAGGACCCTAACTACTTGGCCACCA
TGGCAATGGATGGCATGGAGGTGGTGATTCTAGATGTGCG
TGTGCCGTGTACACCAGTCGCTCGACTCAATAATCACCGT
GCCTGTGTGAATGGCATCGCTTGGGCACCTCATTCCTCCT
GCCACATATGTACAGCAGCGGACGATCACCAGGCTCTGAT
CTGGGACATCCAGCAGATGCCGAGAGCCATCGAGGACCCC
ATCCTGGCCTACACAGCCGAGGGCGAGATCAACAACGTGC
AGTGGGCCTCCACTCAGCCAGACTGGATCGCCATTTGCTA
CAACAACTGCCTGGAGATCCTGCGGGTGTAGAGGAAAAGA
GTCTTTGGCAGAGCAGAGACTTGTTTTTCTAAAGTTCCCG
AGGTCTTGGGGTTTCAAGAGCAGAAACTGGATGAACGGGC
CAATGGGAACGGCGGTCTGAACAATGTGTGTAACTTCTTT
CGTCTGGGAGAATGAGGCGGCGTGAATGAGCATCTGTGTT
TCTGCACAATATATTATTATTATTATAATGGTCTGTTTTC
CTACTTGCCGGGTTCCCAGAGTCTTCATAATGGGATCTTA
AACACAACTGTCGGTTATTATTATTATGATTGTAGGGAGA
GATACATGTTTATTCAGTTTGAGCGGTAAAAAACGATTTA
AGAAAATGCTGCAACTAGGATTGTTAAGATAAAAATTTGC
CAACTTGACGTACAAAACATCTGTACATTCAGATGAATGC
AGTTTTTTCAAAGGTCCTTTGAACTTCAGATTCTTGTTTT
TTTTTTGGTCATTTCAGGAAGGTGCCATTTTGATTCTTGT
TTATTATTTTTTGTAGCCTTGGACACTTAAATGCGAATAA
TATAGAGATAAAATGTTCAGCGTCATTGGTAAACATTGAT
AATTGTTCCTCAAATACACACTTCTAGCAGTTAGCTGACA
TCAATGTTTAAGAAAAATGACACATTTTTTTATATTATTA
TTATTATTATTATTATTAAAAGATTCATCACAACTCAATT
GTGAAAAACTCCTGTTTATTTCTTTAATTTTATTTTCCTC
CATAAAAACATCCCCCTTTCAGCATGCTTGTGCTCGAAGT
GAAACGTGTACTGTATACATATATAAATATTATGTACAAG
GTAGGACAAAAGTGTTGCTTTTCCAGAAGAGTTTTGCATC
GCGAGTCAATATTTGGTCTATCCATGAAGTCGTTCTGTTG
TTATGCAAATATGATGTTGTAGTAACGCCACTCTCGTTGG
TCGAGACCGAAACGAAAAGTGAATTTGCAAGGCTGTGTGG
GATCCTCATCCTCACCTCACACTCTTAGATGGAGTGTTTC
TATGTAAGTAGTTCTCTCTGTGTGTGTGTGTGTGTGTCCA
GCCATGATGCTTTTCTATTATTAAACTCACTTAATAAACT
CTTGTTCTTTCATAAA

dcaf7 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA dcaf7-002 (1) 1040
mRNA dcaf7-201 2496
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dcaf7-201 Contained in:
OTHER dcaf7-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036428 (1)
  • Ensembl_Trans:ENSDART00000058221 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053157 (1) 2289bp
    GenBank:EE331374 (1) 850bp
    CITATIONS (2)