Transcript

grk4-203

ID
ZDB-TSCRIPT-090929-16789
Name
grk4-203
Previous Names
  • grk4-003
  • zgc:153020-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036287 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036287|OTTDARG00000027099|ZDB-GENE-060929-1198 grk4|OTTDARP00000029120 DKEY-58J15.3-003 LG_ BX908747.25 Danio rerio protein_coding KNOWN, 860 bp
CCGAAGTCAAACTGCATCCCATTTTCCGCAACATCAACTT
CAAGCGGCTGGAGGCCAACATGCTGGACCCGCCGTTCTGT
CCAGACCCGCGAGCAGTTTACTGTAAGGACGTCCTGGACA
TAGAGCAGTTTTCGACAGTCAAAGGTGTAAACCTGGACCC
AACAGATGACGATTTCTACCACAAGTTTGTAACAGGGAGT
GTCTCCATCCCATGGCAAAATGAGATGATTGAGATGGAGT
GTTTTAAGGAGATCAACGTGTTCGAGATGGACGGAGCGCT
GTGTGCTGATCTGGATGTGAACAGACCCAATCCAGCACCG
AAGCGAGGATTCTTCTACCGTTTATTTCACCGAGAGGTTT
GTTTTGGGAGTGCCAACAGTGAGGAGGAGGAGAAAGAGGA
GAAGGAGGAGGAGCCATCTTGACTTAAAACCACTCCCACT
TCCCATCAGCTGCCAATCAGAATGCTAAACGTATGAATGT
TCAACTGTATTTATGAACTGTATCAAACTGTATCATAATT
AAAGAAAAGGGTATGAGTTTAAAGAATTTTGTACATTTGT
ACTTGAATTATGTGTAGATGTATATTTTCACTAAAGGTTG
TATTGTACAAAAAGCCATAGAAATACCACTTGAATGCATA
TATAATGTTTTTATTGTTATTATTTTTCATCTGTACTGAA
TATGAAATGTGTATTTCTTTTTAAGCACAATATAAACACT
CACCTTTTGTTTCCAATGCTAACGCTCTGTTAGCACTGCC
TTTGTTTGTATGTTAACTTAGATCGTTTGGCTGGACAGAT
CCACCGCGCTTCTTTTGTACAGCAGGGTAAGATCAATCAC
ACATAAAGAGGGAGCAGTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations