Transcript

grk4-002

ID
ZDB-TSCRIPT-090929-16788
Name
grk4-002
Previous Names
  • zgc:153020-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036286 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036286|OTTDARG00000027099|ZDB-GENE-060929-1198 grk4|no_translation DKEY-58J15.3-002 LG_ BX908747.25 Danio rerio protein_coding KNOWN, 1334 bp
GCTAACAAGGGGGAGAGAGAGTACATGTCCACGGCGAGCG
GAAAGGTGGGGGGTTCAACAGCGAGATATGGAGAAATACA
ATTAACCTGCAATGTGCCAACGCCAAACTCACGCCGATCA
TAACCATCCTCACCACCGATCATCATCATCATCATCATCC
TCACCCTCATCACCACCACCAGCAGCAACGGCGCGACCGA
CCTCGTCTTTTTTCTCCTAAGAAGTGAAATGTATCGGGAC
TGCATGGGATCTTTCTTCTGACAATGGAGATTGAGAATAT
CGTGGCCAACACCGTGCTGCTGAAGGCGAGGGAAGGAGGC
GGAGGGAAGCGTAATGGACGGAGCAAGAAATGGAAGGAGA
TGCTGAAATTGCCTCATATCAGTCAGTGTGAGGAACTGAG
ACGCACAATTGAGAGGGATTATACAAGCCTTTGTGAAAAG
CAGCCAATTGGACGTCAGTTGTTTCGTCAATTCTGTGACA
CTCAGCCCAAATTACGGCGCTGTATAGAGTTCCTGGATTC
TGTGGCAATGTATCAGGTGGCTCCGGATGAGAAGAGGAGA
GACGCCGGTTTAAATATTTTAGACACATATTTTAATAACG
GGTCAGCCGCTCATCTACCAGAGATGGCTCAGGATGTGGT
CGGGGAATGCAGGCAGAAACTGGAACAGAGTCCATGTAAA
GAGCTGTTCCAGGAGTGTACCAGGATAGTTCGTGAATATT
TAAGTGGAGCGCCATTCTCGGCTTATCAGGAGACTATGTA
CTTTTCCCGTTTTCTTCAGTGGAAGTGGTTGGAGAGGTGA
GTAGCTGATCTACGTCAGTCATTGTGATTGGAAATTAATT
TATGAAAAGGAAATGCACATTTTGTTTTTGTCCCTTTGAT
GGCAAGCTATGCATTATCAAGGCCCAGAAAGGTCCCAGCA
GACAAACTACATCATAAGATGTTAATATTAGGTTAGATTT
AGGTTGCCAGCGTCTATGGACAAAGTTATTTTGACGTCTA
ATAATGACGTGAAATGACGTTGATATGTTGTTGATTTTAG
GTTGTGTCGGAAAGTGACCAAACTCCAACATTGAGCCAAC
ATCTTAAACCAACGTCATATTGACGTCAAATACTGACATT
TATTCATCAGATATGGCAACCAAAATCCAACATCTAATAG
ATGTCATAGTTATAAAATCTGCACAACGTCAAGCTGTAAC
ATCGTTAGACGTTGATATTTGTTATTTTTAGGTTCCGTTG
GAAAGTGACCAAAATGCAACATCTGTCCGATGTTGGACAC
TGATCAGCCTGATGTTGGGTTCTGACATCAACCTAATTTT
CATTTTAAAATACG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations