ZFIN ID: ZDB-TSCRIPT-090929-16730
Transcript Name: zic2b-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036222 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036222|OTTDARG00000027069|ZDB-GENE-030219-92 zic2b|no_translation zic2b-002 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 693 bp
GGAGACCAGAGTTTTATAGCTTTTCGTAATGGGTCTGGAC
TATATTCTACACCTGACAAAACCTCAACCAGCTTTGAGAG
AAAGATGTATCCTGCCAGAAACGAAACACAGATTCTTCTC
TCGTAAACGCATAAAACTGGGCGGAGCACCAAGAGCCGTC
AGCACTGATTACTCACGGAGAAAAACCGTTCCTGTGTGAA
TTCGAAGGCTGCGACAGACGCTTCGCCAACAGCAGTGACC
GGAAGAAGCACATGCACGTTCACACGTCTGACAAGCCATA
TCTGTGCAAACTCTGCGACAAGTCCTACACACACCCCAGC
TCCTTGAGAAAACACATGAAGGTTCACGAGGATCAGGCTC
CAATAGCGGACTCCTCTCCTGCTGGAAGCTCCGGGTACGA
GTCCTCCACTCCGTCCAGTCTGATCTCTCCATGCTCGGAG
ACGCACAGCACCTTGTCGCCTGATTCTGCCGCGCTCAACA
GCAGCGGGCACAATAGCTTAACGTCCAATTTTAACGAGTG
GTACGTTTAAGGACTCCGCCAAGAACTGCATATCCTAAAA
TAAAATATTATTTGTAAATAGCAAATGAGGGTTTATGTTC
TCAGCATGTCGGTGTTGCACTGTGAATAAAGAAAGCCGAG
AATTATTATGTGTCTAAAAATGCAGGCAGTTTTCTTCAAT
GAACAACATGTCC

zic2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zic2b-002 693
mRNA zic2b-201 (1) 2248
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zic2b-002 Contained in:
OTHER zic2b-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036222 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DV589362 (1) 727bp
    CITATIONS (1)