ZFIN ID: ZDB-TSCRIPT-090929-16729
Transcript Name: zic2b-201
Previous Name: zic2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036221 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036221|OTTDARG00000027069|ZDB-GENE-030219-92 zic2b|OTTDARP00000029069 zic2b-001 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 2248 bp
TTGGATACACGACGCACAGAGAACCTGCGCAACCGCTACT
AAATCCAATTTGGCTCACCAATCGTACAGATGTACACATT
TCGTACGTTTTCAAAGCTTTTCCATCGCATAAAAAGGATT
TATTTGATTTGACTCAGTTCATCACGTGGCATGAGTTTTA
ATTAACCTAATTACGGGCAAGTAACAGCCACTCAGTTGCT
CATAGCCATATAGCTACTTTTTTTCTATTTAAACGCGGGT
GTAGTGTCTTTACGCATTCTTTGGTCAAAAATCGTGGTGA
TGTTACTGGACGCCGGCCACCAGATTTCTGGTTTAGGGGT
TGGCACGTTCACAAGGCATCACTCGGCTGTGAGCGAGACC
CAGGACAGAGATATGAGTTTTATGGAATCGGCGCACATGG
GCGCGTTCAAACTGAACCACCCCGATTTGTCCCCAGGCCA
GAGCGCAGCTTTTGCGCCACAAGCAAGCAGCTATTCTGCG
GCCGCTCTTGGAGCGCATGCGGCGGCGCACGCTGCCTCTT
TCGCCAGCTCCACTTTTAACTCCACCAGGGAGTTCCTCTT
GCGCAGCCGAGGATTTGGGGATTCGACTCCGGCCAGTGGA
CAACACCCCATCTTCAGCTCCACATCAGGGTCTCTCCATC
ACTCTCACCCAGAAGGTCAGGGTCACCTACTTTTCCCCGG
AATCCACGAGCAGCACGGGTCCCATCACGGCTCTCCAAAC
ATCCTGAATGGACGCCTTGGATTACCCGGTGAGGTTTTCG
GGCGGACGGAGCAGTATCACCAGGTGCCCAATACGCGGGC
CGATCCATACAGCCAATATGGCCTAAACATGAGTATGAAC
ATGGCGCACCATCCAGGCGCGTTCTTCCGCTACATGCGAC
AACAGTGCATCAAACAAGAGCTTATTTGTAAGTGGATCGA
CCCCGAGCAGCTCGGTGACCCCAAAAAATGCTGCAGCAAA
ACTTTCAGCACCATGCACGAACTGGTCACGCATGTGTCCA
CTGAGCACGTTGGCGGGCCAGAACAGTGTAACCACATCTG
CTTTTGGGAAGAATGTCCACGGGAGAGCAAACCATTCAAA
GCAAAGTACAAATTAGTGAATCATATCCGAGTGCACACGG
GAGAGAAACCCTTCGCGTGCCCATTCCCGGGATGTGGCAA
GGTGTTCGCGCGTTCGGAGAATTTGAAAATACACAAACGG
ACACACACTGGAGAAAAACCGTTCCTGTGTGAATTCGAAG
GCTGCGACAGACGCTTCGCCAACAGCAGTGACCGGAAGAA
GCACATGCACGTTCACACGTCTGACAAGCCATATCTGTGC
AAACTCTGCGACAAGTCCTACACACACCCCAGCTCCTTGA
GAAAACACATGAAGGTTCACGAGGATCAGGCTCCAATAGC
GGACTCCTCTCCTGCTGGAAGCTCCGGGTACGAGTCCTCC
ACTCCGTCCAGTCTGATCTCTCCATGCTCGGAGACGCACA
GCACCTTGTCGCCTGATTCTGCCGCGCTCAACAGCAGCGG
GCACAATAGCTTAACGTCCAATTTTAACGAGTGGTACGTT
TAAGGACTCCGCCAAGAACTGCATATCCTAAAATAAAATA
TTATTTGTAAATAGCAAATGAGGGTTTATGTTCTCAGCAT
GTCGGTGTTGCACTGTGAATAAAGAAAGCCGAGAATTATT
ATGTGTCTAAAAATGCAGGCAGTTTTCTTCAATGAACAAC
ATGTCCTTTGGTAGCTAATGCGTTGCCAAAGACAAAGAGT
GGATGTATTTTTAATTTTGGTCTGTATTAATTGTTTTACA
GTAACGTCGGGTCAAGTTACGATGTTTGAATAGCCTACAA
TGTATCTGTCATAGATTAAAGCTATTTGACGTTTCATGAT
TGTCTTACCATGAAAGTATTTTCGGGGATCCTTAAGTGCC
CAAGTCAAATGTTGTACAGTGAAAATGGACACAATTTCGT
GAATGTATTTTATTGTACGAATAATTATTTGTTACTCATG
TAGAAATCATCCACTTCGAGTTAGAGTATTTAGAAATGTC
TCGTTTTTAAATTATGGTATAGCTTATACTTGATAAAATA
CAAAATATTTATGGAAAAACTCGACGAAAATGTGTACAGA
ATTGTTACATTTAAAGTGTTTGTACATTGTTATTCAGTTT
AATGATGTAAATTCTTGTGATAACAAATGCCAAACATTAA
AATGAAGGAAAATATTATATAAAGGCAATAAAATGAAACA
AATCTAAA

zic2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zic2b-002 (1) 693
mRNA zic2b-201 2248
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zic2b-201 Contained in:
OTHER zic2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036221 (1)
  • Ensembl_Trans:ENSDART00000054066 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC098556 (1) 2274bp
    GenBank:EE111255 (1) 2264bp
    GenBank:AF207751 (1) 2239bp
    GenBank:CT658412 (1) 895bp
    GenBank:CT658317 (1) 874bp
    CITATIONS (2)