Transcript

prex1-202

ID
ZDB-TSCRIPT-090929-16725
Name
prex1-202
Previous Names
  • prex1-002
  • si:dkey-48j7.2-002
  • si:dkey-48j7.2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036216 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036216|OTTDARG00000027066|ZDB-GENE-030131-1428 prex1|OTTDARP00000029064 DKEY-48J7.2-002 LG_none CR847543.13,CR450767.13,CR450776.5 Danio rerio protein_coding NOVEL, 551 bp
GTGAAAAAAAAACGTCACGTGTGTACGTTCATCGATTGAT
CTGGTCAGGTCGTTTAAAATAATAGAGGATGTGGACAGGC
ACTGATGGCTGATTGTCATGCTGAGGATGCATCACCTCAA
GGGCACACACGGCTTTTCTCCAGAGGATTAGACAGACTGC
AGAAAACCAGCAATGTCTGACTCAGGAGCAGGTCAAGGTC
TTGTTTTCCAACATCGAATCCATTTTGGATGTCCATCGCG
AGTTCCTTTCCACTCTAGATGCCAGTTTGCAGCCTGAACC
CCAGGCGCATCATTCTCTCGGACATGTTTTTCTCCAGTTT
AAAGTGCGTTTTTCAGTGTATGGCGAGTACTGTAGTAACC
ATGAGAAAGCACTCAGACTACTGATGGAGCTCAACAAGAT
CCCTCACATACGGGCTTTTCTGCTGCACCTCATGTTGTTA
GGTGGTAAGAAGAGCACAGATGTTCCTCTTGAAGGGTATC
TCCTCTCGCCTATACAGAGGATCTGTAAATACCCTTTGCT
ATTAAGGGAACTTTTGAAGAGAACTCCTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations