Transcript

prex1-203

ID
ZDB-TSCRIPT-090929-16724
Name
prex1-203
Previous Names
  • prex1-001
  • ottdart00000036215
  • si:dkey-48j7.2-001
  • si:dkey-48j7.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036215 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036215|OTTDARG00000027066|ZDB-GENE-030131-1428 prex1|OTTDARP00000029063 DKEY-48J7.2-001 LG_none CR847543.13,CR450767.13,CR450776.5 Danio rerio protein_coding NOVEL, 7803 bp
CAGCTCTCACAACACTTTTCATGTAGTCCACACTGAGCAC
TCGTGCACTCGCTTCATCGGCTTTTACTGCACAGTTTAGC
CAGTGATTTAACTGTGACTGATCGTTTCACGTGCACTCCT
CTTTTTTTCCACATCACTTCGCTTCTCTGACCACTTTCTT
CATTTACACCGCAGGCACCAGGTTACTTTTCTGGTCTGAC
TTTTTTTTAAACGGAAGATGTTTTTAATGAGATGCAAATT
GCGCTGCGGTTGACTCCGATGTTGCGCGTCGCTACTTTTA
CAGAAGTTTCTTTAGTTTCAGAATAACATTTTCCCCTGCC
GCATCCTGGCGCGAGGTTGCGTGCAGCGCGCTACGGATTA
AATGGATTAATTACCACATCTTCACCTCAGTTTTCAAACA
ACTGGTTTATATCGAGTTTGTTTGGAGGCGCTTAACTCAA
CGGGTTTTTAAAAATGAGCGAAATAAACACTGAGGAGGAC
AATCAACATGAAAACGAGTGTCTCAGTGGCAAGGACTCGG
ACCGTCAGCTTCGCCTGAGACTGTGCGTTTTAAATGAGAT
ATTGAACACCGAACGGGATTACGTGAGAAACTTGACATTT
CTGCAGTCGGCTTTTCTCCAGAGGATTAGACAGACTGCAG
AAAACCAGCAATGTCTGACTCAGGAGCAGGTCAAGGTCTT
GTTTTCCAACATCGAATCCATTTTGGATGTCCATCGCGAG
TTCCTTTCCACTCTAGATGCCAGTTTGCAGCCTGAACCCC
AGGCGCATCATTCTCTCGGACATGTTTTTCTCCAGTTTAA
AGTGCGTTTTTCAGTGTATGGCGAGTACTGTAGTAACCAT
GAGAAAGCACTCAGACTACTGATGGAGCTCAACAAGATCC
CTCACATACGGGCTTTTCTGCTGCACCTCATGTTGTTAGG
TGGTAAGAAGAGCACAGATGTTCCTCTTGAAGGGTATCTC
CTCTCGCCTATACAGAGGATCTGTAAATACCCTTTGCTAT
TAAGGGAACTTTTGAAGAGAACTCCTAAGAAGCATTCAGA
TTACCCTGCTGTAGAGGAAGCCCTGCAGGCCATGAAAGCT
GTGTGCTGCAACATCAACGAGACCAAGCGGCAGATGGAGA
AATTAGAGGCTCTTGAGATATTACAGTCACACATAGAGGG
CTGGGAGGGAACAAACTTGACTGATATTTGTACTGAACTG
CTACTCCAAGGCAACTTGTTGAAGATATCAGCTGGAAACA
TTCAGGAACGAGTCTTCTTCCTGTTTGACAACCTCCTAGT
CTACTGCAAGAGGAAGTCAAGAGTGTCAGGGAAGAAATCC
ACCAAAAGGACGAAATCCATCAACGGGCCGCAGTATGTGT
TCAGAGGCCGCATCAACACTGAGGTCATGGAGGTCGAGAA
TGTGGAAGATGGAACTGCGGACTATCACAGTAACAACTAC
ACGGTGACCAATGGCTGGAAGATCCACAATACAGCCAAAA
ACAAGTGGTTTGTGTGCATGGCCAAGAATGCTGAGGACAA
GCAGAAATGGCTAGATGCCATTTTAAAGGAACGTGAACAA
AGAGAAAGTCTGAAGCTGGGGATGGAGCGTGACGCATACG
TCATGATTGCAGAGAAGGGAGAAAAGCTGTACCACATGAT
GATGACCAAGAACCGACACCTCATCAAAGACCGCCGAAGG
AAACTCACCAACGTGCCCAAGTGCTTCTTGGGAAATGAGT
TCGTCTCATGGCTGCTGGAGAGTGGAGAGATCAGTAAAGC
TGAGGAGGGAATCAACCTGGGTCAAGCTCTTCTGGAGAAC
GGCATCATCCATCATGTGTCAGATAAGCACCAGTTCAAGA
ACGAGCAGGTGTTGTACCGCTTTCGCTATGATGATGGCAC
ATATAAAGCCAGGAGTGAAATGGAGGACATCATTTCTAAG
GGAGTGAGACTTTACTGTCGTCTCCACAGTCTCTTCACAC
CTGTTGTCAAAGACCGAGATCATCATCTAAAAACATTCAA
ATCCGTCATACCAGCTAGCAAACTGGTAGAATGGCTTGTT
TCACAGGGTGACAGTGCAAGTCGTGAAGATGCAGTGACTC
TCGGTGTTGGACTCTGCAATGCTGGTTTCATGCATCACGT
TTTGGAGAAGAGTGAATTTAAAGATGAGTCACAGTTTTTC
CGCTTCTACGCTGATGAGGAGACGGAGGGCACAAGCTCCA
AGAGTAAACAGCTTCGCAGCGACTTCAAACTCATCGAGAA
CATCCTTGCCAAATCTTTAGTGATCCATCCTGAAGAAGAG
GACTATGGGTTTGAGATTGAAGAGAAGAACAAGGCCATTA
TAGTGAAGAGTGTGAGCAGAGGATCATATGCAGAGATGGC
AGGCCTGCAGCCGGGGAGAAAGATCTACTCCATTAATGAG
GACCTGGTGTTCCTGAGGCCCTTTTCTGAAGTGGAGACCA
TGATCAACCAGTCTTTCTGTATACGCCGCTCACTCAGACT
GCTGGTGGCCACCAAGAACAAAGAGATTGTAAAGATCCCA
GATGTTCATGGCACCCTTCCGTTTGTTCTCTCTGGTTCTT
GTCCACCTCACATTCATGCAGTGAAGAAAGGCTCAGAGGC
AGCAGCAGCAGGTCTTCAGCCCGGTCAGTGTGTGCTTAAA
GTCAACGGCAACAACATGAACCAGAGCGGCTATCAGGAAG
TCCTGGAGCACTTCAGTGGCTATCAGCCTGTTTTGGAGCA
GCAAGACACTAGCTGTGGTCAGTGGGCGTACAGAGTGTAT
GAGGATGTGGAGGAGCAGATGTCTTTTAGGGGTTGTGAGA
ATGGCTCAGATTCAGAAGACGGCTGCACTAATGGAACAGG
CTCTGTAAGAAGGCTGGAGCAGTTGTCCATCTCTGATGAT
GGTCCTTTGGTCAGTCTGAATGTAGACAATGTTCATGTTG
AACATGGGGTTGTGTATGAGTATGTCAGCCCTGCAGGCAT
CAAACACTGCGTGCTGGAGAAGATGGTGGAGCCCAAGGGC
TGCTTCAACCTTACTGCAAAGATACTGAAAGCTTTTGTGA
AGGATGATAGTCTGTTTGTGAAGAGCTGTCGGCAGCTAAT
GGCTCTGAATGATAAGGTTGTGACGATGCCACAGTTTGAG
TTTCGAAACATCTGTGACACCAAGCTGGAGAGCATAGATA
AACGCATTAGCAGCTATAAGCAGTTTGTAGAGGAACTGCA
GACGAAGGCCTGGCCCACGTTTAAGCAGGCGAGCACTAAA
CCGCACATTCTGGGCTGCATGGACTTCGTCCCCACCAACT
GTCACCTTAACCTGATGCAGGTGTCCTGCCCGAAAAATAC
CTCCTCAGCAGGACGGGCCTTTAGCATCCGCTTTGGACGC
AAGAACTCCTTCTTCGGCCTTGATCCTGACCAAGCGAACC
TGAATCCCATGTCCCACTCCGTGCACTGTGTGACCAGCAT
GGGGGCTCCGTCCTTCAGTTGCCAGAGTTTGGATGAAGAG
ACTGAGAACGGTGAAGGGAACTCAGAGGACAGCAGGAAAC
ATGAAGAGGGAGGTCTCAGCTTCCTCCTAAAACAGGAAGA
CACTGAGAGCCAGGACAATTATATCTGCCTCTATAACCGC
CTGGACATTGCAGTCCGAGAGATGAAGCAATACGTGGCCC
AGATAGATGTACTTCTGTCATCGATAACTGGACCAACACA
ACCGCAGGGCTCTGAGCCTCCATCATTCGAGAGCGGCCCC
TCGACCTCCCCCATCCCAGAGGAGACAGACCAAGATAAGA
CTGAGCACTGCGGAAACAAGAGAGTGTGTTTCAAAGTGAA
CGAAGATGATCAGGAGGACTCTGGACATGACACCATGAGC
TACAGAGACTCATACAGTGAATGTAACAGTAACCGAGACT
CAGTGCTGTCGTACACCAGCGTCCGCAGCAACAGCTCTTA
CCTGGGCAGTGATGAGATGGGTTCAGGAGATGAATTGCCA
TGTGATATGCAGATCCCTTTTGACAAGCAGGATAAACTAC
ACGGATGTCTGGAACACCTTTTCAATCAGGTTGACTCGAT
CAACAGTCTTCTGAAGGGCCCTGTCATGAGCAAAGCTTGC
GAGGAAACCAAGCATTTCCACACCGACCACAGTCAGCCAG
AATTTAGGCACACCGATGACTGGACTGTACGCTGGCGATA
CGTTTTGCACAAGAACATCCAGGAGGACCCTTGGAACCTT
CCTATTTCGATCAAATCTCTAATTAACAGCCTTCACCGCT
TTGTAGAGGACACAAAGCTCCAGTTGCGGCGGGATGTGAT
ATTCTGCCAGTCTCTGGTGGGGGCGTTGTGTGCACTGGCG
GAGCAGCTTGTGACTGCACTGAACCTGCGCTTCAATAATA
ACGGAGAGTATGAGGAAGACAGTAAGGAGGTCAGCCACAA
GTGGCTGGAGCAGATCTCCACCATCGGAGTGCTCTTTAAC
TTCCAGTCCACACTCTCTCCACATGTGAGAGAAGAGCGGA
TCATGCTGGAAGATACGAAAGCAGCTCTGCAGGATCTGGA
GAAAGTGACGGTGTTGTTTCGGCCACTGGAGAACGAGTGC
CTCGTCCCAAACACATCTGTGCATTACCAGGTGGAAGGCA
GTCGGCAGGCTATCAGGGTGACGATGTTCCTGGACAACTG
TCATTTCAGTGAACTGCCAACACGACTGCAGAACGGAGGC
TCTCTGAAGCTGCAATCAGTCCTCTTCACTAGAGGGCTGG
AGAAGCCAGAAGGTGTGTTGTCTCAGGATTTTGTTACCAT
GGAAGAGTTTCAGCAACGCACAAATGCTCTCTCACTGGAG
AAGGTCAAAGGTTATTACCGCAAACTCAGGGCTTTTTATC
TAGAGAAGTCTAATTCAGACTCGAATTCTACTGCCATGAA
AATAGATCAGCTCCTGCGGCCGCTCAACACTCTGGATGAC
CTGTGTCGGCTCATGCAGACATATATGAATGTAAAGGCCA
GCTCTGCGGGTCAGCCCTCAGGGGTCAGTGTGCTGCTGGT
GTCCTCTGAGCTCTGCAATCGACTCGGGGCCTGTCAGATC
ACCATGTGTGCCACCGGGATGCAGAGGTGTACTCTGACTG
TGTCGTTGGAGCAAGCTACTATTCTGGCCAGAAACCACAG
CCTCATGCCCCGCTGCTTGATGCAGACCATGGACCTCATG
CGTAAACAGGGCACCAGGGTGGAGATTTCTGCCAAAAACC
TCAGAGTAATGGACCAGATGCCGCCTTTAGCTCCCAGGCT
CTTCAGGTTATGTTTACCCCCATCCGACGGAGACCTTTGA
ACACGGTGATGTTCGTCTCTAACACCTTCTAGAAAACTGA
GAGACATCAAGACTGGTTTATTATTTTGAGAACATCTCAA
CTTCTCCCAGCCAGCTTCACCCAGAGACGTTCGCCTGAGG
TCAATGTCGTGATGAGGAAAGACAACTTGCTAATGCTAAC
GATGCTAATCTTGGCTATCAGCGTCTGCCCACATTGTTTG
GTCTCCTGGTGGATCTGGACTGGCACGTGAATGGCTGTAT
TATCTATTCCTTCCTTCGCCTTTGACTGCAATATTGAGTC
AGCAAGTAGGGTGGTTTGGTCTGGATGGTGATGTCACGTT
CAGATACGTGGTGATTATGTGCAATTACTGTAGCTTAGCA
TGAGTGTGTCTGCACTGTGTGTCAGTGGGAGCTGGTGAGT
TTCTCTCACTCATATCAGGTGTCAAAGAAAATACTGAAAT
CATTCCCGCCTGCAATATACGGACCACTTTAAAATCTGAA
TTCGCTTACAGGATAACAGGGAAACTCAAACTATACAGAA
AAATAGGAGTTTGAAATTTCACGCTAATCACAATTTTGAT
ATTAATTACAAGCAGAACAAATATTCTAATAACGCTCCAC
GTCCCTGGTGTTATAGCACTTTTTAAGCATGACTCAGTGC
TGTGTTAAGAGTGTGAATCGGCTTCATGCGGCTGTTTGGA
GAAAAGCACAATAAAAGAAAGCTCGTGTTCTTCAGTGTTT
TGTTAAGCATACTGTACATTGTAGAAGAAACGCAAAGGGA
TCCTTTGAAGAACGAATAGATATAGTAGGACTTTATTGAG
GTTTTGTATTTAGGCAAATTTATGTATGTTATCAAATGGA
TAAGCATATGCTCTGTGGGAACAGCAGTGCTATAATTTAA
AGAGTATTAATAACGTTAAACAAATATAATATTGTACATC
TCTCATTTGTATACTTAGTGTATATTTGGATAGGAAACTT
TAATGTGCTTTTACACAATGTGTTCAGTATTTAAATTTCT
AACTGGTCAGTAAACCGAGAAGGTCTGGAAATTTGAACGG
TGTACCTAGATTAGTTTGGAGTAGTTAAGCTAGTATGTAC
ATACAGGCTTTTGTTACATTTAGTTACCTTCAGTAATCCT
GACACATGGCCGTATTTAGTTCAATTGAAATAAATAAGGT
CACTATAGTGTCAATATGCTAAAAGCATCTTGGTATAATC
TTATTCCGACATTCATCTTGTTTGTATTATAGCTCATAAC
GCATCTCTCGGTTACATTTCAGCATGGAAGATAGACAATA
CAACTTCAGACCATGTTGTAGTTTTACATGTGATGATAAA
ACATTGTAGAAAAAAAATAATACTTGAATTTAAGCTAATA
CATATCTTTATTTCATTATAACTGTCCAAATTGAAGGCTA
AGATGTAGAATTAATTCAGTATTATTTGGATTTTAACATT
TGATTTGGTCCTCAAACTATAAACAAGTGTTTTTAATCCT
TGGAATCTGTACATTTTAAAGCTCCTCGTCGTTGCTTGTT
TCTATGCTTTATGAAGTCCACACGAAACCTATCATTTCTG
TAAATCTAGTGAAACCCAAAGACGTAGCATTAGCATTAGC
ATGTTCCTATCACTGTATATTAAAATCTCAGGTTTTTCTG
TATCATCTTGGTCCATTATTGTGCGATTAGCTTCCCCTCT
GAATATGATCATGACTAATTTAACATCTCTAATCAGTCAG
CTCAAATATGATATGCACACATTGAAGATTTTAAACTGCT
GATCTGTCTACGGTTCTATTTGAAGTATATATTGCCAATT
TTAACATGCCTCGATTTCAAGTGTACTTTTAGCTCAAAGA
GCGGAAGATATTCAGTGGTGCTTACAAAACAAGCCTTTCT
TTTGGGGGCCTTATAGTTTATAATCTCTGTTTCGTTTGTT
TGTTTCACTTGCAAAAGCCTTTTTTAATCTTCCAGATTTT
GATTGTTCCTATTAATAAGAGCAGTTTAATCAAACCTCAG
CGGTGGAGTGAAGGAGTGGATCTAATCTGCATCAGCAAGT
ATTTAACTTATAGTTTTTATTCATGTTTGACTGTGAAGTC
TCACTGTGTCCTCATTTGTGCTTTATAAGTAAATTAAATG
GCTCTTAAACTTTTTCCTGCTGGAGATGTTAAGTGCATAT
CCAGTTGTTTTAACTCATTGTATAAAGTTTTCCTTTCCGA
TGACGTATGATTAGCTTATGAATAAGTTCTCCAAGATTGC
ACCTTCAGGCAGAACTGAGGACCTGTGCTAAATCAATTGG
TCTGGACTCTCAGAATTGTCTCATTACAGATGTAAAAAAA
ATGCCTTGTACCCCAAAGCTCAAAGTGTCGTTTCTCATTT
CCCAATGCAGCCCCTGATAACCATGTGGTGGATTTATGGC
ACCCTTCGGTCTGACTGGAGTAATTCATTAGATCTCTCGA
TGAAGCTCTGTTAGGTTTGTCTCTTTGCTGTATTTAATGC
ATTGCTAATATCAAACAAAATAAAAGAGTATGTTTATAAT
TTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations