ZFIN ID: ZDB-TSCRIPT-090929-16634
Transcript Name: rev1-002
Previous Name: si:dkey-57a22.7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036094 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036094|OTTDARG00000026177|ZDB-GENE-081105-180 rev1|no_translation DKEY-57A22.7-002 LG_none CR392332.8,CR536604.6 Danio rerio protein_coding NOVEL, 810 bp
GTCATGATGACAGTAAATAATATTTTACTTGATATTTTTC
AAGACACTTCTTTACAGCTTAAAGTGACATTTAAAGGCTT
AACTAGGTTAATAAGGTGAACTAGGTAGGTTAGGGTAATT
AGGCAAGTTATTGTATAACGATGGTTTGTTCTGTAGACTA
TCAAAAAAAAATAGCTTAAAGGGGCTAATAATTTTGTCCC
AAAATTGTTTTTTAAAAAATTAAAAACTGCTTTTATTCTA
GCCGAAATAAAACAAATAAGACTTTCTCCAAAAGAAAAAA
ATATTATCAGACATACTGTGAAAGTTTTCGTGCTCTGTTA
AACATCATTTGGGAAATATTAAAAAAAGAAAAAAAATCAA
AAGGGGGCTAATAATTCTGACTTCAACTGTATATAATTAG
GTTTCATTAAATAACCATATTTATTTTATAAATTGATAAT
ACAAAACAGCTGTGTTCAGAATTGTTATTCATATGATATT
TTAAAAAAGAAACTCCAAAATGAACTGTGCAGCTGAAAGA
GTCAGAAGGATGAGCACTGGGCCACTGCTCTTGCATTTTG
AGTGTATTTGTTTTGTATTTGTGTGTGTGTAGATCCCAGT
GCGGCTGAGTTACGCAGGCTTATGATGTTGCATGGTGGGC
AATTTCATCTGTATTACTCTCGCTCCAAAACCACGCACAT
CATTGCCACCAACCTGCCCAACTTCAAAATACAAGAGCTC
AAAGGAGAGAAAGTAGTGCGGCCAGAGTGGATCATAGACA
GTATAAAAGCAGGTCGCCAACTATCATATATTCAGTATCA
GCTCTATGCG

rev1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rev1-201 (1)    Ensembl 4509
ncRNA rev1-002 810
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rev1-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036094 (1),  Ensembl_Trans:ENSDART00000146435 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT677754 (1) 812 nt
CITATIONS (2)