Transcript

rev1-002

ID
ZDB-TSCRIPT-090929-16634
Name
rev1-002
Previous Names
  • si:dkey-57a22.7-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036094 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036094|OTTDARG00000026177|ZDB-GENE-081105-180 rev1|no_translation DKEY-57A22.7-002 LG_none CR392332.8,CR536604.6 Danio rerio protein_coding NOVEL, 810 bp
GTCATGATGACAGTAAATAATATTTTACTTGATATTTTTC
AAGACACTTCTTTACAGCTTAAAGTGACATTTAAAGGCTT
AACTAGGTTAATAAGGTGAACTAGGTAGGTTAGGGTAATT
AGGCAAGTTATTGTATAACGATGGTTTGTTCTGTAGACTA
TCAAAAAAAAATAGCTTAAAGGGGCTAATAATTTTGTCCC
AAAATTGTTTTTTAAAAAATTAAAAACTGCTTTTATTCTA
GCCGAAATAAAACAAATAAGACTTTCTCCAAAAGAAAAAA
ATATTATCAGACATACTGTGAAAGTTTTCGTGCTCTGTTA
AACATCATTTGGGAAATATTAAAAAAAGAAAAAAAATCAA
AAGGGGGCTAATAATTCTGACTTCAACTGTATATAATTAG
GTTTCATTAAATAACCATATTTATTTTATAAATTGATAAT
ACAAAACAGCTGTGTTCAGAATTGTTATTCATATGATATT
TTAAAAAAGAAACTCCAAAATGAACTGTGCAGCTGAAAGA
GTCAGAAGGATGAGCACTGGGCCACTGCTCTTGCATTTTG
AGTGTATTTGTTTTGTATTTGTGTGTGTGTAGATCCCAGT
GCGGCTGAGTTACGCAGGCTTATGATGTTGCATGGTGGGC
AATTTCATCTGTATTACTCTCGCTCCAAAACCACGCACAT
CATTGCCACCAACCTGCCCAACTTCAAAATACAAGAGCTC
AAAGGAGAGAAAGTAGTGCGGCCAGAGTGGATCATAGACA
GTATAAAAGCAGGTCGCCAACTATCATATATTCAGTATCA
GCTCTATGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations