ZFIN ID: ZDB-TSCRIPT-090929-15377
Transcript Name: rev1-201
Previous Names: rev1-001, si:dkey-57a22.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034640 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034640|OTTDARG00000026177|ZDB-GENE-081105-180 rev1|OTTDARP00000027908 DKEY-57A22.7-001 LG_none CR392332.8,CR536604.6 Danio rerio protein_coding NOVEL, 4509 bp
ACAGACAGGGCTGGCGCTGTCACTGTGTGACCCCGGCTGA
GAGAAGGAGGAGGAGGAGGGTCTTACGCCGAAAACAAGCA
GAAAATCTGGCGGAGGCGACAGTGAGCAAGCGGCTAGCAA
TGAAGAGATACGAGTGAATGGTGAAAGGACTGAATCGTGC
AGTCGCGGGAGCATGTTGATATGGACAGAGCCCAGCATGC
ACGAAGCCTCTGTTTGTAATCCTTCAAAACTGACGCAAAA
GGGGTGGATGCAACCCAAGAGCGGAAACAAAGGCGCTTTG
GTTTGAACAAAAATACATCTGTAAAGAAGGGGGATAATTG
GTCCCTCAGTATGAGTCGAGATGGATGGAGGAAGAAAGCC
AGTGAAAATGATGGGTGGGGAGGACAGGGAGGTTACATGG
CTGCAAAAGTCTCTAAGCTTGAGGAGCAGTTTCAGAAGGA
TGCCCCGAGAGAGCAGAAGAAAGATGGAAAGTCCTCCTGC
ATCTTCAGCGGTGTGGCCATCTATGTCAATGGATACACAG
ATCCCAGTGCGGCTGAGTTACGCAGGCTTATGATGTTGCA
TGGTGGGCAATTTCATCTGTATTACTCTCGCTCCAAAACC
ACGCACATCATTGCCACCAACCTGCCCAACTTCAAAATAC
AAGAGCTCAAAGGAGAGAAAGTAGTGCGGCCAGAGTGGAT
CATAGACAGTATAAAAGCAGGTCGCCAACTATCATATATT
CAGTATCAGCTCTATGCGAAGCAGAAAGGATTAAATTTCA
CCAGAGTTTCTGGAATAGAAGGCCAGGACCCGTCATCCAA
CCATGGACCAGACATCAAGCCTCAGCCGAGCCATACTCTA
TCTAAAGACGTCCTCAAGTCTACTCAGGCTAACCACATGG
CTAACTACACTGAGAAAACCGATCACCAGCTGGATATCAG
GCTCAGAAATGGTTTGCATAGCATTATCTCTGAGGTAGAT
GCAGAGAAATCGAGAGTCAATGGGATTCATGATGATGATG
ATGATGATGACATCGCCTGTTCCATTTTGCCAAGAGGCTC
ACAAGACACTTTGTTAACTAACGGTCATGTACACCCTGTG
AATGGTGCCTTAAAGCCTCAGGACTTTGCAGACCATCATC
CTCATGTTGTTGACAAAGCGTCCAATCAGTCTCACCTCCC
ACAGGACAAATACAGGGAGGGTGAGGAGCCCTGCTGCTCA
TATACTGAATCAAAAGCTAATTCCCATCTGAGGTCCTTAA
TATCAGCAGCCAGTCCTGCAAAGCAGCCTGGTCCTCACAA
TATGCAAACGGACCTCCATCAAAAACCAACATCCAATTCA
GGAACTTTAGGTGCTCCTCAGAAGGCCAGTCTGCATGATC
AGACCACAGTCCGGCTAAATGGGAGTTATCACGTGACCTC
AAACTCCTCCACTCTGGCAAACTCTAGTAACCAGTCAGGA
AAATCCTCTGCAGAGGCTGGAATAATATCCGAGTTCTTTT
CTCACTCAAGGCTGCATCACATTTCTACGTGGCGCAATGA
GTTCTCGGAGTATGTAAACAGCCTGCAGAGCAGACGACGA
GCAGCAGGTGGAGCTGTTTTCTCTGGAAGAGAGAAGCTGA
AGAAGCTCAAAGCTAACTGCAATTCAGTCTCTCACTTTGA
CCCAGGTTCCTTGATGGCTGCTCCTCAGGTGCGTCAGTCA
TGTGTTCTCCATGTTGATATGGACTGCTTCTTTGTCTCTG
TGGGGATTAGACACCGACCAGATCTTATAGGGAAACCAGT
TGCGGTGACTAGTAATCGTGGTCCAGGCCGTGTTGCTCAG
CGCCCTGGTGCAAACCCTCAGCTTGAGTTTCAGTATTACC
AGAATAAACAGAAACATTACAGGAAAGAGAAGACAGATGG
GGATCTTGAGATGACCCCATCTCCACAGGATGGTGAAGTT
CCCAGTAATGGAGTGCATGAAGACCTGGCTGCCCTTTCTA
TGGCAGAGATTGCCTCTTGTAGTTACGAGGCCAGGCAGGC
TGGTGTGCGAAATGGCATGTTCTTTGGTAGGGCCAAGCAG
CTGTGTCCAGATCTGCAGTCTGTTCCATATGACTTCCATG
CTTATAAAGAGGTGGCTCTGGCCATGTATGAGATCCTGGC
CAGTTACACTCATAACATTGAGGCGCTGAGCTGTGACGAG
GCACTGGTTGATGCCACAGCTCTTCTGGTTGAGCTGGGGG
TGTCTCCTGATGAACTGGCACGGTCCATCCGTGAAGACAT
AAAGGAGAAGACTGGCTGCTGTGCCTCAGTTGGAATGAGT
TCCAACATCCTACTTGCTCGGATGGCAACCCGTAAGGCTA
AACCCAAAGGGCAGTATTTACTCAGATCAGAGGAAGTGGA
TGATTTTATTAGAGACCAGCCTGTGTCCAGTTTACCTGGT
GTGGGTCGCTCAATGAGCTCCAAGTTGACCTCTCTAGGAG
TGAGTACCTGCGGTGACCTGCAGCAGTTGTCCCTGTCTCA
ACTGCAGAGGGAGTTTGGGCCACGGACGGGACAGACGCTC
TTTCGCTTTTGCAGGGGACTAGATGACAGACCTGTGCGCA
GTGAGAAAGAGAGAAAGTCTGTGTCTGCGGAGATGAACTA
CAACATTCGGTTCACACAGGTTGAGGAGGCGGAGTCTTTC
CTCAATAATCTCTCTATGGAGGTACAGAAGAGGTTAGAGG
GGGCGGGGCTTAGAGGTCGTCGGGTTACACTGAAGGTCAT
GATGCGGAAACCAGGTGCGCCGGTAGAACCAGCCAAATAT
GGTGGTCATGGGATATGTGACAACTTTGCCAGGTCTGTTT
TACTAGCTCAGCCCACAGACAGTGGTCGAGTGATTGCATC
AGAGGCCATTAAGCTGTTTCATGCCATGAAGCTGAATGTG
AAGGACATGAGGGGAGTGGGGCTGCAGGTGCAGCAGCTGG
ATGGATCACATGCAGACCCTTCAGGACAAGGGCCCTCTCG
TGGCCGATCAATCAGAGACCTGCTTCTGGCCAAACAGTCT
GCCCACAGCCCCAGCAAGGAGTCTCCATCACAAGATGGTT
TAATCAGCGCTTCGTCATCCAGAGCTTTCTCCTCCAATCA
GAAGAGAGTTACCCCTGCATTATCACCGCCACCTTCTACA
TCATCATCATCATCACCACCACCCTCCTTCACCATTATAG
ATCCAATGCCTGGAACAAGTAAAGGAGATTATCACCATCC
ACACACCCCCAACCACGTCAGGGCCTGCCTAAACATCAGC
ATCGAGGTGCCATCTCCCTCTCAGGTGGACCCATCTGTTT
TAAAAGCTTTACCTATAGACATAAGGAGACAAGTAGAGGA
AACCTGGAGATACAGAGAGGAGCAGCCCAGCACTTCTTCT
CATTACTCAACACCACCTCGACCACCCTCCACTCCACCTC
CAGGACCTTCACTTGTTCTGCAGCTCCCAAACCAGCCTGG
TCAACCATGCACAACGGGCATTATATTAGAGCTCCCGGAC
TTCTCCCAGGTTGACCCAGATGTGTTTGCAGCACTCCCTA
GAGAGCTTCAGGAAGAGTTGTGTTCTGCTTACAGAAATAA
GGGAAATGCTCAAGCTCAAGCCAGCACTGTAGTGGAACAA
AAAAACTCATTTCCTCAACTGAAGCAGCCTGCTGTAGGGA
AATTAAAGCGCCGCTACAAAAAAAGAAACACTAGTCCTGC
CAAAAATGGTTCAAGTCCACTAAAAAAAATGTTCCCTGGG
AACAGCCCTGCCAAAACCAGCCCCTCCAAAACTCTTCCTC
TGCCACTCAGAGAACAAGACCTCAAATGCCCGTCCTCTCT
GAGCACAGATGTCCCAGAGACACTACCCAAACCCATTCCT
CGGCCAGCCCCAACCCTTGCAGGAGCGCATGAATTCAGTG
AGATAAGAACGCTGCTGCGTGAATGGGTCACCACCATCTC
AGAACCAATGGAGGAGGACATTTTACAGGTGGTGAAGTAC
TGCACAGAACTAGTGGAGGACAAAGACCTGGAGAAACTCT
ACCTTGTCATCAAGTACATGAAGAGGCTCATGCAGCAGTC
CTCAGAGTCAGTGTGGAGCATGGCCTTTGACTTTGTCCTG
GACAATGTGCAGGTGGTGGTACAGCAAACCTACGGCAGCA
CTTTGAAGATCACATAGGAAGACCGTCTTAACCTCAGTCA
CTGTGACATCAGCTCAGTCCTGCCACCTCGTCATGACAAC
AACTGACTCTGCCAATCATTGTAGCATCACGGTACAAGAT
CAAGCCAATGATGAGGAACAGATTAGCATATACCAGCTTC
ACCCAGAAGCAGCTGAACACTGAACTTTTCTTTTATCATG
ATGTCAGATCTCTAGACTGATGTCTAGAAGTACTTTGGTG
ACGCTCTTCAATCAGGTTGTATTCGTTAACATTAGTTAAT
GCGTTGAGTATCATGACCATAAGATGAATCACTTTTGACA
GCATTTGGTAATCTTGGTTACTGCTAATTCACTAATTTAC
TACTGTTAGTTCCTCTTAATTTATAATGT

rev1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rev1-201 4509
ncRNA rev1-002 (1)    Ensembl 810
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rev1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000034640 (1),  Ensembl_Trans:ENSDART00000134915 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EG570557 (1) 775 nt
GenBank:DT862506 (1) 738 nt
GenBank:EB959458 (1) 574 nt
GenBank:AL923228 (1) 539 nt
GenBank:EB771228 (1) 382 nt
CITATIONS (2)