ZFIN ID: ZDB-TSCRIPT-090929-16478
Transcript Name: ncor2-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035922 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035922|OTTDARG00000001376|ZDB-GENE-030616-81 ncor2|no_translation RP71-71M17.2-003 LG_ AL590153.9 Danio rerio protein_coding NOVEL, 539 bp
TTCCACCTAAGAATGGTTCATTTAGGAATTAAGTTATGTC
AAACCAACCGAAGAAATGTCCAGATTTTCTGACTGGTTCT
GTCTGTTTCTCAGTATGGGATCTCGTTCTCCGGCCAGTAG
CTCTCAGCCCCCAGCCTTCTTCAGTAAACTGACTGAGAGC
AACTCAGCCATTGTCAAGAGCAAGAAGGAAATGATCAAAA
AGATCAGCGCAGAGGCTGAGTTCAACCAGAGCCAACCTGG
GACAGAAATCTTCAACATGCCTGTCTCTACAAATGCAGGA
CCCGTGAGTGTGCGCAGCCACCCGCCACCAGAAGCCAGCG
GTAATACTATCGGTCTGGAGGCCATCATCAGGAAAGCCCT
CATGGGCAAGTATGATGAACAGATGGACGAGCGCTCGCCG
TCCAACTCTGTCAACTCGATGGCTGCCGGAGGGGCAGCTG
CAGTCGTGCCACCAGCTTCAGCAGATGGGCGTTCAGAAGA
CCCCTACTCCCTGCCAGGCAAATCCAAAGGAGGGCGCTCC
AACGGTCGCAAGACTAAAT

ncor2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ncor2-003 539
mRNA ncor2-201 (1) 6325
ncor2-204 (1) 6295
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ncor2-003 Contained in:
OTHER ncor2-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035922 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CR928510 (1) 539bp
    CITATIONS (1)