ZFIN ID: ZDB-TSCRIPT-090929-11
Transcript Name: ncor2-201
Previous Name: ncor2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001484 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001484|OTTDARG00000001376|ZDB-GENE-030616-81 ncor2|OTTDARP00000001302 RP71-71M17.2-001 LG_ AL590153.9 Danio rerio protein_coding NOVEL, 6325 bp
GAACTCTGAGAAGCAGATGCGTCAGTTAGCTGTGATTCCT
CCCATGCTGTTTGATGCCGAACAGCAGAGGATAAAGTTCA
TCAACATGAATGGGCTGATGGATGATCCTATGAAGGTCTA
CAAAGACAGACAGGTCATGAACATGTGGAGCGAACAGGAG
AAGGACACCTTCCGTGAGAAGTTTATCCAGCACCCAAAAA
ACTTTGCCCTGATAGCCTCTTTTCTGGAGAGAAAGACGGT
GGCTGAGTGTGTCCTCTTCTACTACCTGACTAAGAAGAAT
GAGAACTACAAGAACATCGTTCGCAGAAGCTACCGTCGCA
GAGGCAGGAGCCAGAATAACCAGCAGGCACAGCAACAGGT
GAACCGGAACAACCAGGAGGAGAAAGAAGACAAGGAGAAA
GAAAAAGAGGGAGAACGTGAGGAGGACAAAGCGGAGGGAG
ATGACAAAGAGGATGGCATAAAAGATGACACCTCTGGTGA
GGATGGGGAGGAGAAAGAGCCTCCTGTAACCGTTAAAGGC
CGTCGCACAGCGAACAGCCGTGGCCACCGGAAAGGACGAG
TCACTCGCTCCATGACCAATGAACAGGAAGAGAACACTTC
ACCTCTCGGCAGCGAGCTGGCAAACCTGGAGATGAATGAG
AGTTCTCGCTGGACAGAAGAGGAGATGGAGACGGCAAAGA
AAGGTCTGCTGCAGTATGGCCGAAACTGGTCAGCTATTGC
CAAGATGGTGGGCTCCAAAACAGTTTCCCAGTGCAAGAAC
TTCTACTTTAACTACAAGAAGAGACAGAAACTGGATGAGA
TTCTGCAACAGCATAAAATAAAATCGGAGAAAGAGCGTAA
AGCCAGACGTAAAGGGAAAGCTCCTCAAAACGAAGAGGCC
AGCGCTCCATCTGCTGCAGAGGAAGAGGAGATGGAAGGAT
CGGGAGTCAGTGGTAACGAAGAGGAGGCTCAGGAGGATGG
AGAAGGTGGAGCCAATAACAGCTCAGACACAGAGAGCCTC
CCTTCCCCACGCTCCTCAGATGACAGCAAGGTCAAAGAAG
AGGGCTCGGCTCGGCCCAAAACTGCACCCAACGCCACTTC
CTCCTCTTCCTCCACGGACAAGGACATGGCAGCTGCAGAG
ACGGGGATGGACGAGAAGCCAAAAGTGGAGAAGGGAGACG
GGGAGCAGGCAGGAGTGAAGCAGGAGGTGAAGACCGAGCC
AGGGGAAGGCGCTTCAGAGTCAGCCGGAGAGGATAAGAAG
CCTCCTGCCCTGGAGGTGGAGGAGGGCAAGAAAGAGGTCA
AGAAGAAAGAGCACGGGGGAAAGAGTGGAGCTCACGACAG
CGACTCCAGCGCCACATGCAGCGCCGATGAGGTGGAGGAG
ACGGAGAGCTCAGAGAAGAGCAGGCCCAGCTTGTTGAGTT
TTAGCCACGATGGAGTGATCTCTTCTCAAGCTCAGAAACC
GCTGGACCTCAAACAGCTCAAGCAGAGAGCGGCCGCCATA
CCTCCCATTTTGCCAGAGGTGTCAGGACGTGATAACCGGC
CTGGTTTGCCAGGAAAGCAGGCTATGCCGGACGCTCTTGC
GTTGTACCAGCAGCAGATTACCATGGCACATGAATCCTCC
CAGGAGGCCAAACAGCAGCAGCAACAACAGCCAACCAAAT
CACAGCATTACCCTGCGGCAGGGGACTCCGGCAGCCCTCG
GGTCAGGACTCGCAGCCCTGGTATCTCTGACAGAGAGAGA
GAAGAGCTGGAGGGGAACGAGAGATGGCTTCAGGCTCTGC
TACATGGATTACATAAATCCCGGGCGTTCTCTCCTCTTGC
AGATGGCAAGAAGAATCCCGGGGCTGATGACATTCGGGCT
TTAGGTCTAGGCCGGCCAGTGATGTCATCGTACCTCTCGC
CCAGAGACATGGCCAAATTCAGCCAAGAACAGCTGCTACA
CTACAATCCCTCGTTAGCTTCCACTTTACAGCCACAGGAC
AGAATGGCTGCAGTGCGGCCTCTCCATATTCCAGAACCCC
CTCCCCTCATCTCCTCTGCCAAACCTGGTGGCTCCATCAC
ACAGGGTACTCCAGTGCAACTGCACAATCCATCCCATGGC
TCTGAGCATGGGAAAGTCCCAGCTCCAGGATCACTGGCTC
TCTCCTGGGTGGACCAGAGGAAAATGGGCGGGTTTCCAGT
TGTTAAACAAGAGCAGTTGTCTCCTCGTGGGGCTTCCTCC
TCCTCCTCTCAGGCTGAGAATCTTTCCACACAGGACAGTT
CTACATCACGGGGACCCATGCCAGCTGTTCAGGGTGGCAG
CATTACAAAGGGCATCCCTGGCACACGTGTGCACCAGGAT
TCTCCCATATCATATCGAGGTGGTTCTATCACTCAGGGCA
CTCCTGCAGATGTCTTATATAAGGGCACAATAACCCGTCT
CATCAATGAGGACAGTCCCAGCCGAGAGAGAAGCAGAGAG
GACACTCCTTCTAAGGGGCATGTAGTCTATGAGGGCATCA
GCGGACACATCCTTTCCTTTGAACGGCGTCCAAATTCTAA
AGAAGAGGGTTGTGGGGATGTGGGGGCTGGCATGAAGAGG
TCCTATGATATGATGGAGGTTGGCATCTCATCTCGTGTGC
CACCCATCAGAGACCCCCTATCTGAAGGCCTGATCATTCG
AGCAATGCCTCCAGATCGAGATAGTCCTCATCCGCAACTC
ATCCGTGGATCCATATCACAAGGAATCCCACGGGATGATT
GTCAGCGTCGGGAGGTTAAGCAGATGAAAAGAGAGGGCTC
CCCATCACCCCGTGGACCTGGTCATTCCACTGATGCTCTG
AAATCACGCTCACACGAGAGTATGGTACCCACAGTCAAAG
AGGGAGGGCGCTCCATCCATCTGATTCCACCTGAGGGGGT
TGTAATTGGCAAGCCCAAGGAGGGTTCAATCACACAGGGT
ACACCTCTGAAACAAGAGCCCCCCGGCTCATCCAAGCGGC
ATGATGTGCGCTCCATCATTGCCAGCTCTCCACGGCCATA
TTCCGGACTGCCCTCTCATCTAGATCCCAGGGGTTCCGAC
AGGGCTCGTTATGAGGAGGCAGGGGGCAAATCTCGACCCA
GTGCTGTAGTCAGTGCCCCCAGCTCTCTGTCCCGTGTCTC
TCCATTGGCACTGAGTGGAGAGCAGAGCAGCAGGCCTCAC
CACAGTCCAGTGGGGTATGAAGATCATAAAAGATCCAGCT
ACCCTCCGCCCTCACACAGAGCCTCTCCACTGTCTGGCAG
AGAAAACTCACAGCGCGCTCATGAAGGCTCTAGTAAACCC
CAACAGCAGGAGAGAAAGGCCACCCCCACCCCAAGAGAGA
TGGGCTCCACTAAGTCTCCATTGGCAGTGGGTGAGCACAC
TGCAAATTTAGCCTTCGAGAGGATCCTTGGGTTGGGACCG
GACATGTACCGTAGCCAGATGTCTCATTTAACATTTGATG
CTGCAGCTCTGCCCAGGGGTATCCCGATTGACTCAGCGTA
TTACCTGCCTCGTCACCTGGCTCCTGGCCCTGGCTACCCA
CACCCCTATCCACCCTACCTGATCAGAGGCTGTTTCCCTG
AAACAGCAGCCCTGGAAAACAGACAAACGCTTTTCAATGA
CTACATTACCTCTCAGCAGATGCACCAGTGGCCTGCTGCC
GCTGCAATGGCTGCCCAGAGACCTGACCTGCTCAGAGGCC
TCACACCTAGAGAGCAGTCCTTAAACTTAGCCTATTCACC
CACGCCTAGAGGAACATCTGCATCTCCCATGGATCGTATC
ACATATATCCCAGGAACTTCTCCAGGTTTCCCTAGCGGAG
CCTACAACACCTCTCCTATCTCACCAGTAGGAGCCTCTCA
CATGAGCAAGATCCAAGGTGGTTCATCATCTGCTGAAAGA
GAAAGAGAACGGGAGAGAGAGAGAGAAAGAGAGCAGAGAG
AGCGAGAAAGAGAAAGAGAGCGAGAGAGGGACAGGGAGCG
AGATCGAGACCGGGAGCGTGAGAAAGATCGAGACAGGGAC
AGAGAAAGAGACAAGTCTCTCAGCCATGGTAACGTGGAGC
ACGCACCTATATGGAGACCAGGAGCACCTGAACAGATGAG
CGGCAGCAGTTCTCGTCCCCCTTCTCATCCTTACAGTCAC
CAGTCCCCGCTCTCGCCCCGTCCCCAGGACAGCTTGCAGC
AGAGACCAAGCGTCCTGCACAACACCAGCTCCAAGAGCCT
GTCAAACTCTGAGCACAACAATCCTTCTGTGCTGCGACCA
CCAGGCTCTGCTCGCTACCAGGGCTTCAGTGGGCACCTCC
AGAGGTCTGGTTTACCCGGTGAGGGTTACCCATCTGGAAC
GGACCCAAGTGCTAAAGACTTGAGCAGAGATGGGGGCAAA
AGCCATGGGCGAGGAGGTCTGCCCAAACACCAAGACCTTT
CATCCTCTTCTAAATCTGACTCCAAGCTCGCCAGTCCTGG
TGCCGGTGGTACATATCCCTCTCCATACAACCAGGCCCCT
GTTGCCCACCTGCCCACAAGTCGAGGGCACCCCTTGTTGG
CGCCCGAAAGTGGCGGCGGCGGCAGTTCCATCCAATCCCG
TGGCGGGGACAGCGGCAGCAGCGCGTCAAGTAGGGAAAAG
ACTCAAAACAAAGTGATGTCCATACAGGAACACGAACTTC
GAGCACTCGGTAAGACCACCATGACAGCGGCCAACTTCAT
AAACGCGATAATCATGCATCAAATTTCTTGTGATGCGGCG
ATGCCAGAGACTGGTGCGCTCGCGACCAACGGCACCTGTG
ATGCTGTGTCTGCAGCTCAACAGAAGGCATTTGAACAGCT
GTACGGGTCTGAAGACAGACTTTCTCCAGGTCAGCAGTCG
TCATCGGGTGTCAAAGGCTCTCAGAGAGTGGTGACCCTCG
CCCAGCACATCAGTGAGGTGATCACTAAAGATTACACACG
CCAGTCACAGCAAAACCAGATAGGAGGTCAACCATCTCTC
CCGCCTGGTTATGGGTATCACAGCTCTCCTGTGCTGGATC
TCACCCGTCCACCTAGCACCCCTCAAGCCCAAACCCCCAC
AGAGCCCAATTCCCGCTACACCCCAGAGGGCACTTCTGCA
GAAAGGGGCAGAGACAGGTCTCCTCCTCAGAATAAAACCT
CTCCAGTGAGTCTGGCTGCTGATGGGATTGAACCAGTTTC
ACCACCAGGGGCCATTTCAGAGCCTGAGACGCCAGGAGCC
AACTACCCCAATGAACAAGCTGAGCAGGGTATGGGATCTC
GTTCTCCGGCCAGTAGCTCTCAGCCCCCAGCCTTCTTCAG
TAAACTGACTGAGAGCAACTCAGCCATTGTCAAGAGCAAG
AAGGAAATGATCAAAAAGATCAGCGCAGAGGCTGAGTTCA
ACCAGAGCCAACCTGGGACAGAAATCTTCAACATGCCTGT
CTCTACAAATGCAGGACCCGTGAGTGTGCGCAGCCACCCG
CCACCAGAAGCCAGCGGTAATACTATCGGTCTGGAGGCCA
TCATCAGGAAAGCCCTCATGGGCAAGTATGATGAACAGAT
GGACGAGCGCTCGCCGTCCAACTCTGTCAACTCGATGGCT
GCCGGAGGGGCAGCTGCAGTCGTGCCACCAGCTTCAGCAG
ATGGGCGTTCAGAAGACCCCTACTCCCTGCCAGGCAAATC
CAAAGGAGGGCGCTCCAACGGTCGCAAGACTAAATCTCCT
GGTCCTGGCCTGTCTGGAGGCGAAAGACCTTCATCTGTGT
CCTCTGTCCACTCAGAGGGAGACTGTAACCGTCACACACC
ACTCACCAACAGAGTGTGGGAGGACAGGCCCTCATCTACA
GGCCCCACTCCATTCCCCTGCAACCCCCTGACCATGGGGA
TGCGTCTCCCCAGCGGGATCATGCCGGGACCCTCACCTTC
CCCAACACATCCTGGCGCTTCTGCACCCACACAAGGCCAG
ACCCAACCCCGCACCTGGGAGGAAGAACCCAAACCTCTGC
TGTGCTCTCAATACGAGACCCTGTCAGACAGCGAGTGAAC
ACACACACACCGAGAACGTTTGCTGCTTTCTGAACAGAAA
CTTGTTACTGTAAACAGGGGTGTTTGTGAGCACACTCACT
CATATCCATACTGACACACACACACATACTCACACTCTCT
TACGGGAACATACGTCCATCCATGCTCATGCCCTCTGATA
CCTCCACACATATGCATACATGCACACATCCCATAATGCT
CTCCAAGCGGGCACATTCACACTGTCAGTGAAAGTGCATT
ACATGGCTGCAGTGTTCGTAGATGTGTTTGTGAATGTGCA
CACTTGCATTAGTGTGTGCAGTCACTCCAGGACTACTTGT
AGGAA

ncor2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ncor2-003 (1) 539
mRNA ncor2-201 6325
ncor2-204 (1) 6295
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ncor2-201 Contained in:
OTHER ncor2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001484 (1)
  • Ensembl_Trans:ENSDART00000001092 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI891682 (1) 751bp
    GenBank:BE200863 (1) 662bp
    GenBank:BI533777 (1) 631bp
    GenBank:BI981417 (1) 617bp
    GenBank:BI430161 (1) 579bp
    GenBank:BE017685 (1) 488bp
    CITATIONS (2)