header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-163
Transcript Name: vps35-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002297 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002297|OTTDARG00000002130|ZDB-GENE-030131-2042 vps35|OTTDARP00000002029 RP71-34G2.3-002 LG_ AL928906.4 Danio rerio protein_coding NOVEL, 763 bp
TCGAAGCGACGTTAAATTATTTTATTGTCATTAGATGCTA
ACCGAATGTTGTTCAGAGAAACTATTATTTTCTAAATACA
ATTTACCTCAGTTATTATTCTATAATGACACAACGCAGCT
AATTTTACTATTATGGATACATAAATAATAATTCTCAGTA
TTGTTTCTAGAGGGTTTTAAAGACGGATAATACAGCTTTT
ATGTCTTGTGATGTGTGCGGGCAGCGCTCGTCATGAGGCG
GAACAGCAGCAGTCACATGATACGACACATTCACAGGGGG
GTCATCCAGTATTTCCTCTAACATACCTGATAATCATGCC
CACCACACAGCAGTCGCCGCAGGATGAGCAGGAGAAACTG
CTGGATGAAGCTGTGCAGGCAGTCAAGGTTCAGTCATTTC
AAATGAAGCGCTGTCTGGACAAGAACAAGCTGATGGATGC
ACTGAAACATGCCTCAAATATGCTGGGGGAGTTGAGGACG
TCCATGCTCTCTCCTAAGAGCTATTATGAACTCTATATGG
CCATTTCAGATGAGCTGCATTACCTGGAGGTGTATTTGAC
TGACGAGTTTGCCAAAGGTCGCAAAGTGGCTGATCTCTAT
GAGCTTGTTCAGTATGCAGGGAACATCATCCCTCGACTGT
GAGTATCAAAAGTCTCTTTTCAGGAAAGTCTGTTCACTCA
GTGACCATATTTGCAACGCCTCCAGGCAGCTATTTTGGGC
ATACAGATTCAAGTCCTATATGTTTCAATAGAGTGCATTA
GAG

vps35 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA vps35-002 763
vps35-004 (1) 646
vps35-005 (1) 701
mRNA vps35-201 (1) 3573
vps35-203 (1) 752
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vps35-002 Contained in:
OTHER vps35-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002297 (1)
  • Ensembl_Trans:ENSDART00000138800 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL730031 (1) 546bp
    CITATIONS (2)