Transcript

vps35-201

ID
ZDB-TSCRIPT-090929-162
Name
vps35-201
Previous Names
  • vps35-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002296 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002296|OTTDARG00000002130|ZDB-GENE-030131-2042 vps35|OTTDARP00000002028 RP71-34G2.3-001 LG_ AL928906.4 Danio rerio protein_coding NOVEL, 3571 bp
TCGAAGCGACGTTAAATTATTTTATTGTCATTAGATGCTA
ACCGAATGTTGTTCAGAGAAACTATTATTTTCTAAATACA
ATTTACCTCAGTTATTATTCTATAATGACACAACGCAGCT
AATTTTACTATTATGGATACATAAATAATAATTCTCAGTA
TTGTTTCTAGAGGGTTTTAAAGACGGATAATACAGCTTTT
ATGTCTTGTGATGTGTGCGGGCAGCGCTCGTCATGAGGCG
GAACAGCAGCAGTCACATGATACGACACATTCACAGGGGG
GTCATCCAGTATTTCCTCTAACATACCTGATAATCATGCC
CACCACACAGCAGTCGCCGCAGGATGAGCAGGAGAAACTG
CTGGATGAAGCTGTGCAGGCAGTCAAGGTTCAGTCATTTC
AAATGAAGCGCTGTCTGGACAAGAACAAGCTGATGGATGC
ACTGAAACATGCCTCAAATATGCTGGGGGAGTTGAGGACG
TCCATGCTCTCTCCTAAGAGCTATTATGAACTCTATATGG
CCATTTCAGATGAGCTGCATTACCTGGAGGTGTATTTGAC
TGACGAGTTTGCCAAAGGTCGCAAAGTGGCTGATCTCTAT
GAGCTTGTTCAGTATGCAGGGAACATCATCCCTCGACTGT
ACTTGTTGATAACTGTTGGAGTGGTGTACGTTCGCTCTTT
CCCCCAGTCCCGCAAAGACATACTGAAGGACCTGGTGGAG
ATGTGTCGCGGGGTGCAGCATCCACTGCGTGGCCTTTTTC
TCAGAAACTACCTGCTGCAATGCACGCGCAACATCCTGCC
AGATGACGGAGAACAGGCCGAGGAAGAGATGACCGGAGAC
ATTAATGACTCCATTGACTTTGTGCTGCTGAATTTTGCGG
AGATGAATAAACTGTGGGTGCGAATGCAGCATCAGGGACA
CAGCAGGGACCGAGAAAAGAGAGAGAAAGAGAGGCAAGAG
CTGCGCATCCTCGTTGGAACTAATCTGGTCCGCCTGAGCC
AGCTGGAAGGCGTCAATGTGGAAAAGTACAAACAGATCGT
GCTGTCTGGGGTCTTGGAGCAGGTGGTGAACTGTAGAGAC
TCTCTAGCACAGGAATACCTCATGGAGTGCATCATACAGG
TCTTTCCGGATGAGTTCCACCTGCAGACATTGAACCCGTT
CCTTCGTTCCTGTGCCGAGCTGCACCAAAACGTGAATGTC
AAGAACATCATCATCGCTCTTATTGATAGATTGGCCCTGT
TTGCTCACAGAGAAGATGGACCTGGAATCCCTGCTGAAAT
CAAGTTATTTGATATTTTCTCACAGCAAGTGGCAACTGTC
ATACAGTCTCGTCAGGACATGCCCTCTGAAGATGTTGTTT
CACTCCAAGTGTCTCTCATCAATCTGGCCATGAAGTGCTA
TCCTGACCGTGTGGATTATGTGGATAAAGTGTTGGAAAGC
ACTGTGGAGATTTTCAACAAGCTGAACCTGGAACACATTG
CCACCAGCAGCGCGGTGTCTAAAGAACTGACCAGGCTACT
AAAGATCCCTGTGGACACGTACAATAATATCCTAACTGTG
CTCCAGCTCAAGCATTTCCCTCCGCTCTTCGAGTACTTCG
ATTATGAGTCACGCAAAAGCATGAGCTGCTACGTGCTGAG
CAACATTCTGGACTACAACACCATAATCGTGGCCCAAGAT
CAGGTCGATGCGATCCTGAACCTGGTGTCTACGCTGATCC
AGGACCAGCCTGATCAGCCTGCTGAGGATCCGGACCCAGA
GGACTTTGCAGAGGAACAGAGCCTAGTGGGCCGCTTCATT
CATCTGCTGCATTCAGACGACCCTGACCAGCAGTATCTGA
TTTTAAACACTGCCAGGAAACACTTTGGCGCTGGAGGGAA
CCAGAGGATTCGCCACACTCTTCCCCCGCTGGTGTTCGCT
GCGTATCAACTGGCCTTTCGTTACAAAGAGAACTCCTCCT
CAGATGATAAATGGGAAAAGAAATGTCAGAAGATTTTCTC
ATTCGCCCATCAGACCATCAGTGCTCTGATCAAAGCTGAG
CTGGCCGAGTTACCCTTAAGGCTCTTCCTCCAGGGCGCTC
TGGCGGCAGGCGAGATCGGCTTTGAAAACCATGAAACTGT
GGCCTACGAGTTCATGTCTCAGGCATTTTCTCTGTATGAA
GATGAGATAAGCGATTCCAAGGCACAGCTGGCCGCCATTA
CGCTGATCATTGGCACGTTTGAACGCACACGGTGCTTCAG
CGAAGAGAACCATGAGCCCCTTCGTACCCAGTGTGCTCTG
GCGGCCTCCAAACTGCTGAAGAAGCCCGATCAGTGCCGTG
CAGTCAGCATCTGTGCCCACCTTTTCTGGTCAGGACGCAA
CACTGACAAAGGAGGAGATGAGATTCGTGATGGACGTAGG
GTGATGGAATGCTTGAAGAAGGCTCTGAAGATTGCCAACC
AGTGCATGGACCCGTCCTTGCAAGTCCAGCTCTTCATCGA
GATCCTCAACAGATACATCTGCTTCTATGAGCGAGAGAAT
GATGCGGTGACGGTCCAGGTCCTGAATCAGCTGATCCAGA
AGATCCGTGAAGATCTCCCGAACCTGGAGGCCAGCGAGGA
GACGGAGCAGATCAACAAACACTTCCACAACACACTGGAG
CACCTGCGTCTGCAGAGAGAGTCGCCCGAGTCTGAGGGAC
CTGCTTACGAAGGGCTGGTGCTGTAGGTGCCTCACACATC
CACATTTATATTTGTGTACACACACACACACACACACACG
TATATAGAGAGATTTATGTATATGCCCACATGTGCACACC
AGGGTATTCCAGCCAGGGGAAAAAAACGAAGCCAAACCCA
CCTGCCTCTCTGCTCATTTCTCATTTCTCATACTTTTCAG
TCGGTTGTTTTCGTCCTCTGCCCTCTGCCTCTGTCTTACT
GATTTTTGTGAGGCGTTTTCTTGTGAATTCCTTAGAGAAC
AATTTATGCACTGCACTCCTACTCCGCGCTTCCTTCAAAC
TGCCATTCCCTATTAATAATATTGTTGCCATACAAATGAG
CAAGAGTAAAAAAAAATACATATTTAAGAGAGAAATATAA
CCGTTCTAGTGTTGCTACAGCACTTCTTTGTCCCGCTGGC
CAAACTGGAGCAAAAATGCAGAACTTTTATTGAGCCACGC
ATTGTTCAAGTCTTCAATTAGAGGACCTACACTTGATTCT
GTTTGTCTTTTTGTTTTGTTTCAGCATTAATATTTTAAAA
GCTGTGCTAAGTTAAACACATTCGTGTAACTAATGAATAG
TCCTGTTTCTCAACCTTTTACTTTCACGGCAGACACTTAG
GTGGAGTGGGACAGTGTGTTGACTAATATGTGGAATGGTT
GAACGTGTATAGACTCTATTAATGAATGAGTAGCTGTGGC
TGTGAATCCAAACCAATGTCCGAAGCCTTCTCTTGCATCT
TGTTTCCCTTTTTTTGAAATTATGACTCCCCCTCCCTTCA
TGTATTGTATGTATAATCTAATTGTAAATCAGTTACAACA
AAATATCATTGATTTCATGGCATTTGCACAAATAAAAAAA
TGTTAACCCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations