ZFIN ID: ZDB-TSCRIPT-090929-162
Transcript Name: vps35-201
Previous Name: vps35-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002296 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002296|OTTDARG00000002130|ZDB-GENE-030131-2042 vps35|OTTDARP00000002028 RP71-34G2.3-001 LG_ AL928906.4 Danio rerio protein_coding NOVEL, 3571 bp
TCGAAGCGACGTTAAATTATTTTATTGTCATTAGATGCTA
ACCGAATGTTGTTCAGAGAAACTATTATTTTCTAAATACA
ATTTACCTCAGTTATTATTCTATAATGACACAACGCAGCT
AATTTTACTATTATGGATACATAAATAATAATTCTCAGTA
TTGTTTCTAGAGGGTTTTAAAGACGGATAATACAGCTTTT
ATGTCTTGTGATGTGTGCGGGCAGCGCTCGTCATGAGGCG
GAACAGCAGCAGTCACATGATACGACACATTCACAGGGGG
GTCATCCAGTATTTCCTCTAACATACCTGATAATCATGCC
CACCACACAGCAGTCGCCGCAGGATGAGCAGGAGAAACTG
CTGGATGAAGCTGTGCAGGCAGTCAAGGTTCAGTCATTTC
AAATGAAGCGCTGTCTGGACAAGAACAAGCTGATGGATGC
ACTGAAACATGCCTCAAATATGCTGGGGGAGTTGAGGACG
TCCATGCTCTCTCCTAAGAGCTATTATGAACTCTATATGG
CCATTTCAGATGAGCTGCATTACCTGGAGGTGTATTTGAC
TGACGAGTTTGCCAAAGGTCGCAAAGTGGCTGATCTCTAT
GAGCTTGTTCAGTATGCAGGGAACATCATCCCTCGACTGT
ACTTGTTGATAACTGTTGGAGTGGTGTACGTTCGCTCTTT
CCCCCAGTCCCGCAAAGACATACTGAAGGACCTGGTGGAG
ATGTGTCGCGGGGTGCAGCATCCACTGCGTGGCCTTTTTC
TCAGAAACTACCTGCTGCAATGCACGCGCAACATCCTGCC
AGATGACGGAGAACAGGCCGAGGAAGAGATGACCGGAGAC
ATTAATGACTCCATTGACTTTGTGCTGCTGAATTTTGCGG
AGATGAATAAACTGTGGGTGCGAATGCAGCATCAGGGACA
CAGCAGGGACCGAGAAAAGAGAGAGAAAGAGAGGCAAGAG
CTGCGCATCCTCGTTGGAACTAATCTGGTCCGCCTGAGCC
AGCTGGAAGGCGTCAATGTGGAAAAGTACAAACAGATCGT
GCTGTCTGGGGTCTTGGAGCAGGTGGTGAACTGTAGAGAC
TCTCTAGCACAGGAATACCTCATGGAGTGCATCATACAGG
TCTTTCCGGATGAGTTCCACCTGCAGACATTGAACCCGTT
CCTTCGTTCCTGTGCCGAGCTGCACCAAAACGTGAATGTC
AAGAACATCATCATCGCTCTTATTGATAGATTGGCCCTGT
TTGCTCACAGAGAAGATGGACCTGGAATCCCTGCTGAAAT
CAAGTTATTTGATATTTTCTCACAGCAAGTGGCAACTGTC
ATACAGTCTCGTCAGGACATGCCCTCTGAAGATGTTGTTT
CACTCCAAGTGTCTCTCATCAATCTGGCCATGAAGTGCTA
TCCTGACCGTGTGGATTATGTGGATAAAGTGTTGGAAAGC
ACTGTGGAGATTTTCAACAAGCTGAACCTGGAACACATTG
CCACCAGCAGCGCGGTGTCTAAAGAACTGACCAGGCTACT
AAAGATCCCTGTGGACACGTACAATAATATCCTAACTGTG
CTCCAGCTCAAGCATTTCCCTCCGCTCTTCGAGTACTTCG
ATTATGAGTCACGCAAAAGCATGAGCTGCTACGTGCTGAG
CAACATTCTGGACTACAACACCATAATCGTGGCCCAAGAT
CAGGTCGATGCGATCCTGAACCTGGTGTCTACGCTGATCC
AGGACCAGCCTGATCAGCCTGCTGAGGATCCGGACCCAGA
GGACTTTGCAGAGGAACAGAGCCTAGTGGGCCGCTTCATT
CATCTGCTGCATTCAGACGACCCTGACCAGCAGTATCTGA
TTTTAAACACTGCCAGGAAACACTTTGGCGCTGGAGGGAA
CCAGAGGATTCGCCACACTCTTCCCCCGCTGGTGTTCGCT
GCGTATCAACTGGCCTTTCGTTACAAAGAGAACTCCTCCT
CAGATGATAAATGGGAAAAGAAATGTCAGAAGATTTTCTC
ATTCGCCCATCAGACCATCAGTGCTCTGATCAAAGCTGAG
CTGGCCGAGTTACCCTTAAGGCTCTTCCTCCAGGGCGCTC
TGGCGGCAGGCGAGATCGGCTTTGAAAACCATGAAACTGT
GGCCTACGAGTTCATGTCTCAGGCATTTTCTCTGTATGAA
GATGAGATAAGCGATTCCAAGGCACAGCTGGCCGCCATTA
CGCTGATCATTGGCACGTTTGAACGCACACGGTGCTTCAG
CGAAGAGAACCATGAGCCCCTTCGTACCCAGTGTGCTCTG
GCGGCCTCCAAACTGCTGAAGAAGCCCGATCAGTGCCGTG
CAGTCAGCATCTGTGCCCACCTTTTCTGGTCAGGACGCAA
CACTGACAAAGGAGGAGATGAGATTCGTGATGGACGTAGG
GTGATGGAATGCTTGAAGAAGGCTCTGAAGATTGCCAACC
AGTGCATGGACCCGTCCTTGCAAGTCCAGCTCTTCATCGA
GATCCTCAACAGATACATCTGCTTCTATGAGCGAGAGAAT
GATGCGGTGACGGTCCAGGTCCTGAATCAGCTGATCCAGA
AGATCCGTGAAGATCTCCCGAACCTGGAGGCCAGCGAGGA
GACGGAGCAGATCAACAAACACTTCCACAACACACTGGAG
CACCTGCGTCTGCAGAGAGAGTCGCCCGAGTCTGAGGGAC
CTGCTTACGAAGGGCTGGTGCTGTAGGTGCCTCACACATC
CACATTTATATTTGTGTACACACACACACACACACACACG
TATATAGAGAGATTTATGTATATGCCCACATGTGCACACC
AGGGTATTCCAGCCAGGGGAAAAAAACGAAGCCAAACCCA
CCTGCCTCTCTGCTCATTTCTCATTTCTCATACTTTTCAG
TCGGTTGTTTTCGTCCTCTGCCCTCTGCCTCTGTCTTACT
GATTTTTGTGAGGCGTTTTCTTGTGAATTCCTTAGAGAAC
AATTTATGCACTGCACTCCTACTCCGCGCTTCCTTCAAAC
TGCCATTCCCTATTAATAATATTGTTGCCATACAAATGAG
CAAGAGTAAAAAAAAATACATATTTAAGAGAGAAATATAA
CCGTTCTAGTGTTGCTACAGCACTTCTTTGTCCCGCTGGC
CAAACTGGAGCAAAAATGCAGAACTTTTATTGAGCCACGC
ATTGTTCAAGTCTTCAATTAGAGGACCTACACTTGATTCT
GTTTGTCTTTTTGTTTTGTTTCAGCATTAATATTTTAAAA
GCTGTGCTAAGTTAAACACATTCGTGTAACTAATGAATAG
TCCTGTTTCTCAACCTTTTACTTTCACGGCAGACACTTAG
GTGGAGTGGGACAGTGTGTTGACTAATATGTGGAATGGTT
GAACGTGTATAGACTCTATTAATGAATGAGTAGCTGTGGC
TGTGAATCCAAACCAATGTCCGAAGCCTTCTCTTGCATCT
TGTTTCCCTTTTTTTGAAATTATGACTCCCCCTCCCTTCA
TGTATTGTATGTATAATCTAATTGTAAATCAGTTACAACA
AAATATCATTGATTTCATGGCATTTGCACAAATAAAAAAA
TGTTAACCCCA

vps35 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vps35-201 3573
vps35-203 (1)    Ensembl 752
ncRNA vps35-002 (1)    Ensembl 763
vps35-004 (1)    Ensembl 646
vps35-005 (1)    Ensembl 701
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vps35-201 Contained in:
[BAC] RP71-34G2 (1)

Genome Resources: Vega_Trans:OTTDART00000002296 (1),  Ensembl_Trans:ENSDART00000016105 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BF156274 (1) 689 nt
GenBank:AW422852 (1) 675 nt
GenBank:BQ263236 (1) 639 nt
GenBank:BI878917 (1) 628 nt
GenBank:AW423120 (1) 626 nt
GenBank:BI891945 (1) 606 nt
GenBank:AI957872 (1) 567 nt
GenBank:AA658726 (1) 514 nt
GenBank:AI585185 (1) 489 nt
GenBank:BI984332 (1) 463 nt
CITATIONS (2)