ZFIN ID: ZDB-TSCRIPT-090929-16121
Transcript Name: spata6-203
Previous Name: spata6-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035504 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035504|OTTDARG00000022125|ZDB-GENE-050417-351 spata6|OTTDARP00000028533 spata6-003 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 576 bp
ATTGATTCTGTCAGACGCTCTGTATTCTTCACATCCATTG
TGTCAGGATGTGCCGCCACTGTCTTCCAGGATAAAGAGAG
TGAGGAGGAGGAGAAGGGAGTCACACAGAGTTCATGTGTT
TCCGCCCACTGTGGTTCAGTGATTGACAGCCGGCTGCAAC
AGGACAGTAGAAGTATTTCTGGAGAACCATCTGCTCATGT
AGAAAGTGGAACATTCTGGACCAACAGAGCGACAGCAAAC
ACAGAGACGTCCCACAGAGCAGTCTTTGAGGACAGTCTGA
GCAAAATTTACAAGGAGCTCTACAAAAACGCATCACTAAA
CACCTGGACACAGTGACCACACACAACTCCAGATATATAT
GGCTGGTAAACTGCAGGTTTTTTCAGTTGTTTTGCCACAA
ATTTCTGAACCCTGATGTCACTTTTTAAAACTCTGAACAG
TCACTACTTTTAACAGGTTTCCTAGTGTTTAAAACATTGC
ATGTTGCGTTCATTTCTTTAGAGAAGTCTTGCATTTGCAG
GATTATAGGTTCACATAATCCTTTTATCATACAAATAGTA
CAGAAACACAACTTTA

spata6 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript spata6-202 (1)    Ensembl 747
mRNA spata6-201 (1)    Ensembl 1865
spata6-203 576
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spata6-203 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035504 (1),  Ensembl_Trans:ENSDART00000140867 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB913598 (1) 525 bp
GenBank:EB968289 (1) 484 bp
GenBank:EB959925 (1) 439 bp
GenBank:EB969296 (1) 132 bp
CITATIONS (2)