header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10897
Transcript Name: spata6-202
Previous Name: spata6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028402 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028402|OTTDARG00000022125|ZDB-GENE-050417-351 spata6|OTTDARP00000028534 spata6-002 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 747 bp
TAAAAACACTGGCGGACTGAAGACGCCCAAAATCCCTCAG
CGTCACAAATGCGACAAAAAGCGAATAAATGCACCGTCGA
ATTAAAAGTACAAGCTACCTTTGTAGGAATGCTTGACCCG
GCTGCTGTAGCTGAACATCTAGAGAATGATACAACGTCTT
TAGAGCTCATTCAGCTTGTTCCTCCAGTCACATGGTCGAT
CCTCTGCTAAGCCCAGTTCTATGAGAACTTGCCTTTCTTC
TGCAAAAAAGAAGAAGAAATCAGACAAAGTATCATCTTGT
GGGTATGAAAAGTCAACAGTGGCATCCAGAAGCCGAGCTC
CATCACCTTACACTCACCGTAAAATGTGTCAGCTGTCCGA
GGAGGCCAGACAGCGACTCAGCCACCTCAAACTTGGGCCT
TACACATTTCAGAAAGAGACGGCCCCTCAGGCTCCATTTG
TGGTCCCCCGAAGCCCAAATACATCTCTAATGGAATCCTC
CACGCATCTAACATCTCAGTCTTTTACTAAACGAAGCCCC
CTAGATATGCGATTACGGAGCTACACCACAGAGCTTACAG
ATCCCTCTCTGCTTGGAAGCTTCAGGTCAAAGCCCTCACA
GGAAGCAGCTAGAAGTTTCCCAAATAAATCTCCCAAAGAC
AAATCCACCCCAGCGTCCGGAATGCTTCTAGATCAGAGTC
CAGTGCTGACCCGATCTTCCCTGAGAGAACGGTTCCAGAG
TTCATCCAGTCCCTCGCAGTCACAGGA

spata6 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript spata6-202 747
mRNA spata6-201 (1)    Ensembl 1865
spata6-203 (1)    Ensembl 576
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spata6-202 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000028402 (1),  Ensembl_Trans:ENSDART00000137923 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DT075183 (1) 755 bp
CITATIONS (2)