header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16087
Transcript Name: abl2-202
Previous Name: abl2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035467 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035467|OTTDARG00000026649|ZDB-GENE-020809-2 abl2|OTTDARP00000028505 abl2-002 LG_none CR450721.6,CR381644.8 Danio rerio protein_coding KNOWN, 1984 bp
ATGAAAGGAGAATCCTCAACACATCGGGTCTGTGTTTTGT
TCCATGTGAGATTAGACATTAGTCTAGCGCCGCTAGATTA
TGACATTGAGGACCCTTCCGTCCAGCAGCAGTTTTGAGGA
AGAGTGGGTCAGGCTGACCAAACTACCCAGCACACAGGAT
GACCACTATTGCCTCGCAGAAGCCCTGCACAGGCCGTTTG
GACTGGACTCGACGGCGCTGACGGAGGCGGTGCGCTGGAG
CTCCAAGGAGAATCTGCTGGGTGCTGCTGAAAGTGACCCC
AACCTTTTTGTGGCACTTTACGACTTTGTTGCCAGTGGTG
ACAACACACTAAGCATCACGAAAGGAGAGAAGCTGCGAGT
GTTGGGTTATAACCAGAATGGAGAATGGAGTGAAGTCCGC
TCAAAGAACGGCCAGGGCTGGGTACCCAGTAACTACATCA
CCCCCGTAAACAGTCTGGAGAAGCACAGCTGGTACCATGG
GCCCGTGTCCCGCAGCGCTGCCGAGTACCTGCTCAGTAGC
TTGATCAACGGCAGCTTCCTGGTGCGGGAAAGCGAGAGCA
GCCCCGGCCAGCTCTCCATCTCTCTTCGCTATGAGGGACG
GGTCTATCATTACCGCATCAACACGGCCTCTGATGGAAAG
GTCTATGTGACAGCAGAGAGTCGTTTCAGCACGTTAGCTG
AGCTGGTTCATCATCATTCCACAGTTGCGGATGGACTGGT
AACCACTCTGCATTATCCTGCTCCCAAATGCAACAAGCCC
ACCGTCTACGGCGTCTCTCCCATCCACGACAAGTGGGAGA
TGGAGCGCACCGACATCACCATGAAGCACAAATTGGGTGG
AGGACAGTACGGAGAGGTGTACGTTGGAGTTTGGAAAAAG
TACAACCTCACTGTAGCTGTAAAAACACTAAAGGAGGACA
CCATGGAGGTTGAGGAGTTTCTTAAGGAGGCCTCAGTCAT
GAAGGAGGTCAAACATCCCAATCTAGTACAGTTACTGGGT
GTGTGTACTTTGGAGCCTCCCTTCTACATTGTGACCGAGT
ACATGCCCCATGGGAACCTGCTGGATTACCTGCGTGAGTG
TGAAAGGGACCAGGTGAATGCTGTGGTGCTGCTCTACATG
GCCACTCAGATCTCCTCCGCCATGGAGTATCTGGAGAAGA
AGAACTTCATCCATAGGGACCTGGCAGCTCGTAATTGTCT
AGTAGGAGAGAATCACGTGGTGAAGGTGGCTGATTTCGGA
CTGAGCCGTCTGATGACGGGTGACACCTACACAGCTCATG
CGGGAGCCAAATTCCCCATCAAATGGACCGCACCAGAGAG
TCTGGCCTACAACACCTTCTCCATCAAATCAGATGTGTGG
GCATTTGGAGTTTTGCTTTGGGAGATTGCGACGTACGGCA
TGTCTCCATATCCAGGAATTGACCTGTCTCAGGTATATGA
TCTGCTGGAGAAGGGCTACCGCATGGAGCAGCCCGAAGGC
TGTCCTCCTAAAGTCTACGAGCTCATGAGAGCCTGCTGGC
AGTGGAGTCCACTGGATAGACCCTCATTTGCTGAGATTCA
TCAGGCCTTTGAAACCATGTTTCATGACTCAAGCATTTCA
GAAGAGGTAGCTGAAGAGCTGTGTAAAACTGCGTCTGGTG
GGCAGAGTGGAGTTGCCCACACCTTCGGCCCTGATATGCC
ACTCTTGCCCTCAAAGTCTCGTGGGCAGAAGAAACACTCA
GAGAACAAAGAGAATATGGAGGAGGCAGGACCCCACGGCC
CTGCAGGTATACAGGCTCAACTCCGGCTCAGTCGGCTCAG
AAAGAAGCTCAAGAGAATGGGAGTGGTGTTCCTTATTGAT
TAACACAACTACCCAGTATATAACCTCTTTAAATATATTT
AATGTGGATTGGGTTAAGAAAGTTATGTGTTGTATTTATA
TCATTGTCTTTATTCACGTGTATCAATATGAGAAGACTCG
CATGTTTATAAACAGTCAACAGTT

abl2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abl2-201 (1)    Ensembl 5883
abl2-202 1984
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abl2-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000035467 (1),  Ensembl_Trans:ENSDART00000138548 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH465404 (1) 931 bp
GenBank:EV758090 (1) 913 bp
GenBank:DT062034 (1) 843 bp
GenBank:CT663574 (1) 674 bp
GenBank:AF164769 (1) 633 bp
GenBank:BQ169366 (1) 593 bp
GenBank:BQ169367 (1) 561 bp
GenBank:EB980097 (1) 533 bp
CITATIONS (2)