header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16086
Transcript Name: abl2-201
Previous Name: abl2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035466 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035466|OTTDARG00000026649|ZDB-GENE-020809-2 abl2|OTTDARP00000028504 abl2-001 LG_none CR450721.6,CR381644.8 Danio rerio protein_coding KNOWN, 5883 bp
GAATCCTCAACACATCGGGTCTGTGTTTTGTTCCATGTGA
GATTAGACATTAGTCTAGCGCCGCTAGATTATGACATTGA
GGACCCTTCCGTCCAGCAGCAGTTTTGAGGAAGAGTGGGT
CAGGCTGACCAAACTACCCAGCACACAGGATGACCACTAT
TGCCTCGCAGAAGCCCTGCACAGGCCGTTTGGACTGGACT
CGACGGCGCTGACGGAGGCGGTGCGCTGGAGCTCCAAGGA
GAATCTGCTGGGTGCTGCTGAAAGTGACCCCAACCTTTTT
GTGGCACTTTACGACTTTGTTGCCAGTGGTGACAACACAC
TAAGCATCACGAAAGGAGAGAAGCTGCGAGTGTTGGGTTA
TAACCAGAATGGAGAATGGAGTGAAGTCCGCTCAAAGAAC
GGCCAGGGCTGGGTACCCAGTAACTACATCACCCCCGTAA
ACAGTCTGGAGAAGCACAGCTGGTACCATGGGCCCGTGTC
CCGCAGCGCTGCCGAGTACCTGCTCAGTAGCTTGATCAAC
GGCAGCTTCCTGGTGCGGGAAAGCGAGAGCAGCCCCGGCC
AGCTCTCCATCTCTCTTCGCTATGAGGGACGGGTCTATCA
TTACCGCATCAACACGGCCTCTGATGGAAAGGTCTATGTG
ACAGCAGAGAGTCGTTTCAGCACGTTAGCTGAGCTGGTTC
ATCATCATTCCACAGTTGCGGATGGACTGGTAACCACTCT
GCATTATCCTGCTCCCAAATGCAACAAGCCCACCGTCTAC
GGCGTCTCTCCCATCCACGACAAGTGGGAGATGGAGCGCA
CCGACATCACCATGAAGCACAAATTGGGTGGAGGACAGTA
CGGAGAGGTGTACGTTGGAGTTTGGAAAAAGTACAACCTC
ACTGTAGCTGTAAAAACACTAAAGGAGGACACCATGGAGG
TTGAGGAGTTTCTTAAGGAGGCCTCAGTCATGAAGGAGGT
CAAACATCCCAATCTAGTACAGTTACTGGGTGTGTGTACT
TTGGAGCCTCCCTTCTACATTGTGACCGAGTACATGCCCC
ATGGGAACCTGCTGGATTACCTGCGTGAGTGTGAAAGGGA
CCAGGTGAATGCTGTGGTGCTGCTCTACATGGCCACTCAG
ATCTCCTCCGCCATGGAGTATCTGGAGAAGAAGAACTTCA
TCCATAGGGACCTGGCAGCTCGTAATTGTCTAGTAGGAGA
GAATCACGTGGTGAAGGTGGCTGATTTCGGACTGAGCCGT
CTGATGACGGGTGACACCTACACAGCTCATGCGGGAGCCA
AATTCCCCATCAAATGGACCGCACCAGAGAGTCTGGCCTA
CAACACCTTCTCCATCAAATCAGATGTGTGGGCATTTGGA
GTTTTGCTTTGGGAGATTGCGACGTACGGCATGTCTCCAT
ATCCAGGAATTGACCTGTCTCAGGTATATGATCTGCTGGA
GAAGGGCTACCGCATGGAGCAGCCCGAAGGCTGTCCTCCT
AAAGTCTACGAGCTCATGAGAGCCTGCTGGCAGTGGAGTC
CACTGGATAGACCCTCATTTGCTGAGATTCATCAGGCCTT
TGAAACCATGTTTCATGACTCAAGCATTTCAGAAGAGGTA
GCTGAAGAGCTGTGTAAAACTGCGTCTGGTGGGCAGAGTG
GAGTTGCCCACACCTTCGGCCCTGATATGCCACTCTTGCC
CTCAAAGTCTCGTGGGCAGAAGAAACACTCAGAGAACAAA
GAGAATATGGAGGAGGCAGGACCCCACGGCCCTGCAGGTC
TTGCAACATCCCTTTTTGTTGGTGATGGCCGCTCTAGCAG
CTCTCCAGCCTTGCCTCGTAAACAGCGGGATAAGTCTCCC
TCTAGCCTGCTGGAGGACTGCCAGGACACCACCTTCACCC
GTGATCGGAAGGCTGGCTTCTTCAGTTCATTCATGAAGAA
GAAGTCCATGTCCTCCTCTTCTGCTACATCCTCACCTCAG
CAGCAGCAGAACCTCCCAATGCCTCCCAAGAGGAGCAGCT
CTTTCAGGGAGATGGAGACCCAGCCCCATAAAAAGTATGA
GCCCACGGCTGGGTTTTCAGGTCCTCCTCCTCCTCTGCCT
CAGACTGATGGATTGAGTTTCTCTCCATCTCACGGAGAGG
GAAATCATGTGCAGTCCCGCTGTTGTGGGGCCACATTTGG
GCAAAAGCCTTCAAGTTCAAACTCTGGAGCAACTTCTGGT
CAAGTGGGAAGCAGCAGTAGCTGGGGAAGCCTAGCGGGCT
TTTTCACCCCTCGCCTTATTAAAAAAACTCTAGGATTGCG
GACTGGTAAGTCTTCTGGAATAGACGAAGTGAGTGGAGCC
AAGCCATTCCCTCGCTCCAACTCAACATCCTCTATGTCTG
CTGGGTTGCCAGATTTAGAACGCATGGCATTGACGTTACC
AAGAAACCGTAGCAAACCTCCACTAGAACGCACATCTTCT
ACCACCTCACAACCGGAAAATGGGGCAACACGACCTTCAG
ATGCAATCCTGAGAAAGCTTGACGAAGGTACAGCTCAGAT
ACGGGATCGTCCCAAAGCCAAACTCTTGCCACGAGGGGTC
GCAGGTGGAGTTAGGGCACCAGGTGTAGGGGGAGAGGCAG
AATCGGACTCAAACACAAGGGGGAAAGATGGGCAAGATGA
CAGGCAAGGCTGGTCATCTCCATCCAAAACCTCTACCCTT
GGTTCTGTCAATCTGCATAACCACAAAGTTCCAGTGCTGA
TCTCCCCGACTTTAAAGCACAGCTCGGGTGATGCACACCT
AGTCGGCGTGGACTCTCAGGGCAACCGCTTCAAACTACTG
TCCGATAGTGGGGATCGTGACCGACCACGTCTGGTGAAGC
CAAAATGTGCACCTCCCCCACCGCCCATGCTACGCTCCCT
CCAACACGCCTACAGTGCCGATGCAGCTGACGAAGTGGTC
AGTGGGAACATGGAGGTCAATGGAGATACCATCAAAAGGT
CGGGAAGAGAAGTCAGGGGAGCACGTCCGTCAATACCACC
ACCACAAGTGCCTCCAGCCCCTGTAGTTCCCTCGAGTAAC
AACACCACCCAAACCAAGTTGGCTAATGGTGCTTCAAGTG
GCGGACCAGGCCCTACTTCAGCTAAACCCACTCTTAGACG
GACTCGGCAGCAGACAGAAAGGATCCCTCTTGAGAAGATC
AGTAAGGAAGCTCTTCTGGAATGTGCTGAATGTTTGAGTA
GTGCTCTTCAAGGTAACTCCGAGCTTTCGTCCAGCAGCCA
GGTCCTGGATGTGGGACACCAACTTTTGGACTACTGCTCG
GGGTATGTTGATTGCATCCCACAGACACGTAATAAGTTTG
CCTTTCGAGAGGCTGTAGGGAAACTGGAGTTGAGTCTACA
GGAGCTGCGCGCTTGCTCTACGGGTGGGGGAGTGGGACTT
AGTGGACCTGGGACCAGCCCAGCTCTTGACAACTTGCACA
TGTGCATTAAAGAGATCAGTGATGTTGTTCAAAGGTAGCC
ACTGTGTTTACCTGTAGCTACACCTTCCAAAACTCCTCCT
CCTCCTGTACCCCTTGAGACTTTCTTTTTTTTAACCTCCC
AAAATCAATCTAGTTTTATTTAAATGTTGGGGGCAGAGAA
CATTCTCTAAGAAGTACCTCAGAAAAATACTACAAACACA
CTCGCTCTATCTCTTTATTGTTTACAGGTGACTTCCTCCT
TGAAATTGCCAGTTGGGAACAGAGTTTTTTTTGTATATAA
GCTTTTTGTCACAACCAAAATACAATTTTGTTTTTGACAA
AATTTTCTTTTTAATCAATATTTGCAGTTTTATCTTGATA
TGAGAGAATCAGTTTTTACAAAAAGACTGGGGTTACACAG
GTTTGGGTCAGCCAACTGCACCATAACTGGTCTACTTAAT
GGTCCATTTTGTTATGTTAAAGATTTCAATTCAATTTTTG
GATATTCAGTGCACATTTAAACAAATTACATTGCATCAAA
ATGTCAGTGGAAACATACAAATGCCCACAATTAAGAAATC
ATTCATGGCTTTGTTATAATATTGCTAGTTTAAAAGAAAC
ACTGTGGAATGCAGCAAACACAGCCAATCCAATGCACATC
TCATTTTAGCCATTACATGTGCATCTCTCTACATCCCATA
CTGTCATTTTTAATTTGATCACATTTGTTGAACAATCCAG
CTTTTGATATCCCTTGACAGTTTTATAGATCTTTTTGTAA
CTGGTCCTTATTTCGACATGGTCCATGTGTTATTGTTGCT
CATAGTGGTTTGTGTGGCGTAGTTGAAATGGTGTTGGGTC
TGTCACCACATGGATCCTATTTGGCCTTCTATATCCGTGG
CCTTTCAATAATGCCCCCATCAGCCAGATGGCACAAAACT
ACATTCAGTCTCTCGAGTTCTCAAGAATTCTCAACTTTTA
TTGATTTGCTATGGGGGAATTATGATTTGTGGAAAGGAAT
TTATTTTGGGATGTGAATAGTGTGCCAACATTAGCAGCAA
CACTACATACACAAGTATTGCCAAGTCTTTTAACACAAAC
TGCAATTGCTTTAGCACATTGATTTGTAAATTTATTTTGA
TTTCACTTTATAATGTCGCCATTTGTAAACTTGAATTTTA
AATTATTTTTATTCAAAGCACAGGCATTTTTATGATATTG
TAGATATTATTTGATACCCACGAACAGGCTGTGGAAGGTC
ATGCTCACTTGTGTCCTTGTGGTGAGATTTTGGTGTCAGG
GTCACCATCTCTGCATCTGCATTATGAATGTATTCATTTG
TTAAAAACAGGAATGTTGTTTTGTGTGTGTGTGTGTGTTT
GTGTGTGTGACTGCGTGTGTGTGATTGCGTTTAATTTTTC
AGTCTTTTCTCAAATAGAAACAATTAAAAGAGAGATTTCT
TCAGGACACAAATGGTTACACATTTTCTGAGTCTTCATAA
AAATAATAGATTTCTATCAGAATTTGCATAAATGAGATTT
TTGTGGGTACCCTGCAATGTCAATGTTGAAATGTAAAGAG
AAAGATTTGTACCGATTACACTGGAGCACATTTTTAAACA
TAAATGTTTATTGCCTTGCCTTAATTCACTATCTAGGGTA
TGAAATATGGAATTAATAAAGGAAGAAATATTTTCCCCCT
TCTCCATGACGGTTTCACTGCAGCAGGAAAAACATGCATC
ATGTTTGTTTGGAATTTTTTATTGCCACTCTGAATCATTT
GCCAACGCTAACTCCTTTACCCTTTGTTTTTCTGCCATGG
GCAATGTTTTCTGATATTACATGGTGCCTTTGTGAGATAT
TCAATGTCTGTGCACTGCAGAGTCATGTTAAAGTTCTGTT
CATGTAAATGTGTTTTGCTCTCAAAAGTTCGATATTGATT
TTAAGGTGGCAAATTGGAATTTTTCAAGCCTTTATCATCA
TTTAGACTGTCCTGGTCAGATATCTCGGGATTTGAGGTGT
CCAGCTTGAAAAGGAAAAAGTGCAATGATCTGTCCTTTAC
TAAAGAAAAACAGTGCTTGAAGTCTGGTCTGATTTTACAG
AAAGAGCTCATCATTTGGTCAGGAAAACCTCTCTTGTAAT
CACATTGGGAAGATTTTTGATTTAAGTTTGTCTTTGAAAC
ACGTGCAGGTCATCTATTCCATTTATTATTATGTCTGGAA
ATATTTGGTGAGCAAGCTGAGGGGGAAGAGTTTTGTATGT
CAGTTTTACATGATTGTCAGGGAGTATTTTGCCTTTTTAA
ATTCCTTTTTGTAGTGAAACAGCTATTTTTTTCTCCCATT
CATTTTCACCTAACATCACAGTTTGTATTTTAATTAGGTC
TTTTTAGCCATAATCAGAAGGTTTTGTTTTAAATGTTCTT
CCATAAATTAATCAAATTAGCTATGTTTCCATCCAAAAAT
GCG

abl2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abl2-201 5883
abl2-202 (1)    Ensembl 1984
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abl2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000035466 (1),  Ensembl_Trans:ENSDART00000041697 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH584372 (1) 945 bp
GenBank:EB913044 (1) 610 bp
CITATIONS (2)