header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15994
Transcript Name: ptpn18-002
Previous Name: zgc:113105-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035358 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035358|OTTDARG00000022075|ZDB-GENE-050320-12 ptpn18|no_translation DKEY-161M5.1-002 LG_ CR450770.21 Danio rerio protein_coding KNOWN, 464 bp
CAACGCCGTACACGCATTTCTCAATTTGCTTGTTTTTGTT
TCTTTTTCGTTATATTGTAAATCCAAGACTTCTCTGTACA
TCAATGCAGTTCCACCGAAGATTTCACAAAAATCTGCATC
ATTAGCCCCTGCCCGTGCACCAGCAAAAACAAGAAATCCA
CATCTCAAGCCCAGGCTTTCTCTTCCTCAGTCTACAATGA
ATGACACTTATGCTGTCATCAACAAGTCCAAAGTCCAGGC
TCCCAACTCTGCCCCCCATTCAGTCACTGTCCATTTCTAT
GACAATGCAAATTCAGAGAAAACCAATAACAGTGCTGTCT
ACAGTACAGTCAAACCTAAAACCAGACCAGTGTCTGCCAT
GCCTCTTTCCCCCTCACCAATTCATGACAGACCAATGCCA
GCCAATCAGAGAGGAGGACTTTCACTAAAGAAGATGGAGA
GTGATGGATATGAGCTACTGCCAG

ptpn18 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptpn18-201 (1)    Ensembl 2386
ncRNA ptpn18-002 464
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptpn18-002 Contained in:
[BAC] DKEY-161M5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035358 (1),  Ensembl_Trans:ENSDART00000134952 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD588884 (1) 500 bp
CITATIONS (2)