Transcript

ptpn18-201

ID
ZDB-TSCRIPT-090929-10826
Name
ptpn18-201
Previous Names
  • ptpn18-001
  • zgc:113105-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028328 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028328|OTTDARG00000022075|ZDB-GENE-050320-12 ptpn18|OTTDARP00000023161 DKEY-161M5.1-001 LG_ CR450770.21 Danio rerio protein_coding KNOWN, 2386 bp
GAAACATCAGCAGGCAGGACAAACTTCCCTGTGTCGCCTT
TACTGCCTAAATAACGTCTCAAAGACGGAAACACGGCAGC
TTTGGAGGTCATATATTTGTAGTGAAGATTGTACAGGGAG
TTCTGTAGCAGAAATGACAGAGTGAGATGCTTCTAAGTGG
GATAATACGATGATGGAAGCGCACCTGTTGAGCTTTGTAA
AGCGGGTCAACTGTTTGTCCAACCATGACAGAAGCGGAGA
CCAGCTCATATCCTCCGAGTTCAGCTTGATTCGAAAGAAA
ACTGCATCACTGAAAGAGGATTATGGACTGACTACTAATG
CAGGAGGAATGAAAGAAAATGTGAAGAAAAACCGCTATAG
GGATATCCTGCCTTATGATCAGACCAGAGTATGTCTAACT
CCAACCACATCTGAATATCAGTCCGATTATATTAATGCAA
ACTTCGTCAAGGGAGCTGTTAGAAACAGGACATATATTGC
CACCCAAGGCCCTTTGAGCAGCACTGTGGTTGATTTCTGG
CGTATGATTTGGCAACATAATGTTAAGGTCATAATCATGG
CTTGCAGAGAGATTGAGATGGGGAAGAAAAAGTGCGAAGT
GTATTGGGCATCAACCTCAGACACATCCACACTTGGACCC
TTTACTGTCTCAACTTTGGAGGAGTCCCGTCCAAATGAAG
AAGTTATTGTTAGGACACTGGTGGTAAATTATTGTGATGA
AGCCCGTAAAGTGTCTCATTTCCAGTATACAGCCTGGCCG
GACCACGGCATTCCAGACATGCCGGATGGCATTCTGGGTA
TGATGGAGTTGGCTCGCCAAAAACAGGGCAACCAGACGGA
CCCCGTAGTGATCCACTGCAGCGCCGGCTGCGGTAGAACT
GGAGTTATTTGTGCTGTTGACTATGTGAATGATCTTCTGT
TGACTGAGCAAATACAAGAGGATTTTAATATTTTGGACTT
GGTGTTGGAGCTCAGAAGACAGAGACCTTCAGCTGTGCAG
ACTAAGGAGCAGTATGGATTTGTCTTTCATACGGTTGCTC
AGATGTTTCAGAAGGCTTTGGAAATGAAAAACATGAATGC
AGATACTTCTCTGTACATCAATGCAGTTCCACCGAAGATT
TCACAAAAATCTGCATCATTAGCCCCTGCCCGTGCACCAG
CAAAAACAAGAAATCCACATCTCAAGCCCAGGCTTTCTCT
TCCTCAGTCTACAATGAATGACACTTATGCTGTCATCAAC
AAGTCCAAAGTCCAGGCTCCCAACTCTGCCCCCCATTCAG
TCACTGTCCATTTCTATGACAATGCAAATTCAGAGAAAAC
CAATAACAGTGCTGTCTACAGTACAGTCAAACCTAAAACC
AGACCAGTGTCTGCCATGCCTCTTTCCCCCTCACCAATTC
ATGACAGACCAATGCCAGCCAATCAGAGAGGAGGACTTTC
ACTAAAGAAGATGGAGAGTGATGGATATGAGCTACTGCCA
GGGGAGTTGAGGTCCATGAACAGAGATTCACAGCCGCACG
GCCCTCCTCTTTCACGAAGCCCAAGTGCAACTGAAAGCCA
ATCGTCTACAGATGATGATTATGAATACGTGTCTAGTGTT
GTTAAGGACGGCAGCAGCCCATTTGCTCCGGGCAGCCTGG
GTTTCAACAGTCGAATAAAGAAACCCAAAGGCCCGCGAGA
ACCACCGGCCGAATGGAGTCGTGCGGAAAGATGAAACTGC
AAAAGGTTTTAGGTTTTTTTAAAATTAACCAGAGCTAGTG
TAGCCTGATCCAGTAGACACATGGCTGTTATTTTTTTCTC
TGGGGAATAGAGCATTTATTTATTTCCTTCAGAGGTAGCA
CTGTTGATTGTGTTTGTATTGTTGCGACACTTCAGTCAAT
TGAAAATGTTAACCCAGAATCATTGTGAATACGTACTCAG
GTCTACATTTCTGGGGACAGTGAAATGCATAACCGGAGGT
ATGTCTGTTTGGAGTTTTTGTTTTTGCCGACCCACCAGAG
GCCACTGTGTACATGTTTTGATGATCTCACATTTCTTTCC
TGCAACCTTTCTTGTGTAAATCCACCAGAGGGCGCAATAT
ATATATTTCAACAGATTAGGGATCTGTTTCCCAAACATCG
CCATAACTTGCGGCTGAACTATAATAGAACAATGCCTCGT
GTGGGAAAAGAACGATGTAGTGAGGAGTGTTTCCTAAAAC
CGTAGTTGCTTTGTCGCAGATCCATCCATGAATCATGTTA
GTTATAACATAAAACATAAATTTACATTCCTATGTAATTA
TCATAATGCTCTAAATGGGCGGAGTAACATCTTTTTTAGA
GAAAAGCCCCATAATACAAGCAAAATATATTTTTTTTACA
AGCACATGCATTGAAAAAAAATCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations