header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10826
Transcript Name: ptpn18-201
Previous Names: ptpn18-001, zgc:113105-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028328 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028328|OTTDARG00000022075|ZDB-GENE-050320-12 ptpn18|OTTDARP00000023161 DKEY-161M5.1-001 LG_ CR450770.21 Danio rerio protein_coding KNOWN, 2386 bp
GAAACATCAGCAGGCAGGACAAACTTCCCTGTGTCGCCTT
TACTGCCTAAATAACGTCTCAAAGACGGAAACACGGCAGC
TTTGGAGGTCATATATTTGTAGTGAAGATTGTACAGGGAG
TTCTGTAGCAGAAATGACAGAGTGAGATGCTTCTAAGTGG
GATAATACGATGATGGAAGCGCACCTGTTGAGCTTTGTAA
AGCGGGTCAACTGTTTGTCCAACCATGACAGAAGCGGAGA
CCAGCTCATATCCTCCGAGTTCAGCTTGATTCGAAAGAAA
ACTGCATCACTGAAAGAGGATTATGGACTGACTACTAATG
CAGGAGGAATGAAAGAAAATGTGAAGAAAAACCGCTATAG
GGATATCCTGCCTTATGATCAGACCAGAGTATGTCTAACT
CCAACCACATCTGAATATCAGTCCGATTATATTAATGCAA
ACTTCGTCAAGGGAGCTGTTAGAAACAGGACATATATTGC
CACCCAAGGCCCTTTGAGCAGCACTGTGGTTGATTTCTGG
CGTATGATTTGGCAACATAATGTTAAGGTCATAATCATGG
CTTGCAGAGAGATTGAGATGGGGAAGAAAAAGTGCGAAGT
GTATTGGGCATCAACCTCAGACACATCCACACTTGGACCC
TTTACTGTCTCAACTTTGGAGGAGTCCCGTCCAAATGAAG
AAGTTATTGTTAGGACACTGGTGGTAAATTATTGTGATGA
AGCCCGTAAAGTGTCTCATTTCCAGTATACAGCCTGGCCG
GACCACGGCATTCCAGACATGCCGGATGGCATTCTGGGTA
TGATGGAGTTGGCTCGCCAAAAACAGGGCAACCAGACGGA
CCCCGTAGTGATCCACTGCAGCGCCGGCTGCGGTAGAACT
GGAGTTATTTGTGCTGTTGACTATGTGAATGATCTTCTGT
TGACTGAGCAAATACAAGAGGATTTTAATATTTTGGACTT
GGTGTTGGAGCTCAGAAGACAGAGACCTTCAGCTGTGCAG
ACTAAGGAGCAGTATGGATTTGTCTTTCATACGGTTGCTC
AGATGTTTCAGAAGGCTTTGGAAATGAAAAACATGAATGC
AGATACTTCTCTGTACATCAATGCAGTTCCACCGAAGATT
TCACAAAAATCTGCATCATTAGCCCCTGCCCGTGCACCAG
CAAAAACAAGAAATCCACATCTCAAGCCCAGGCTTTCTCT
TCCTCAGTCTACAATGAATGACACTTATGCTGTCATCAAC
AAGTCCAAAGTCCAGGCTCCCAACTCTGCCCCCCATTCAG
TCACTGTCCATTTCTATGACAATGCAAATTCAGAGAAAAC
CAATAACAGTGCTGTCTACAGTACAGTCAAACCTAAAACC
AGACCAGTGTCTGCCATGCCTCTTTCCCCCTCACCAATTC
ATGACAGACCAATGCCAGCCAATCAGAGAGGAGGACTTTC
ACTAAAGAAGATGGAGAGTGATGGATATGAGCTACTGCCA
GGGGAGTTGAGGTCCATGAACAGAGATTCACAGCCGCACG
GCCCTCCTCTTTCACGAAGCCCAAGTGCAACTGAAAGCCA
ATCGTCTACAGATGATGATTATGAATACGTGTCTAGTGTT
GTTAAGGACGGCAGCAGCCCATTTGCTCCGGGCAGCCTGG
GTTTCAACAGTCGAATAAAGAAACCCAAAGGCCCGCGAGA
ACCACCGGCCGAATGGAGTCGTGCGGAAAGATGAAACTGC
AAAAGGTTTTAGGTTTTTTTAAAATTAACCAGAGCTAGTG
TAGCCTGATCCAGTAGACACATGGCTGTTATTTTTTTCTC
TGGGGAATAGAGCATTTATTTATTTCCTTCAGAGGTAGCA
CTGTTGATTGTGTTTGTATTGTTGCGACACTTCAGTCAAT
TGAAAATGTTAACCCAGAATCATTGTGAATACGTACTCAG
GTCTACATTTCTGGGGACAGTGAAATGCATAACCGGAGGT
ATGTCTGTTTGGAGTTTTTGTTTTTGCCGACCCACCAGAG
GCCACTGTGTACATGTTTTGATGATCTCACATTTCTTTCC
TGCAACCTTTCTTGTGTAAATCCACCAGAGGGCGCAATAT
ATATATTTCAACAGATTAGGGATCTGTTTCCCAAACATCG
CCATAACTTGCGGCTGAACTATAATAGAACAATGCCTCGT
GTGGGAAAAGAACGATGTAGTGAGGAGTGTTTCCTAAAAC
CGTAGTTGCTTTGTCGCAGATCCATCCATGAATCATGTTA
GTTATAACATAAAACATAAATTTACATTCCTATGTAATTA
TCATAATGCTCTAAATGGGCGGAGTAACATCTTTTTTAGA
GAAAAGCCCCATAATACAAGCAAAATATATTTTTTTTACA
AGCACATGCATTGAAAAAAAATCCAA

ptpn18 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptpn18-201 2386
ncRNA ptpn18-002 (1)    Ensembl 464
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptpn18-201 Contained in:
[BAC] DKEY-161M5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000028328 (1),  Ensembl_Trans:ENSDART00000132158 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC091656 (1) 2400 bp
GenBank:DV600116 (1) 740 bp
CITATIONS (2)