ZFIN ID: ZDB-TSCRIPT-090929-15976
Transcript Name: itpr3-202
Previous Names: itpr3-002, ottdart00000035337, si:dkey-163f12.8-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035337 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035337|OTTDARG00000026569|ZDB-GENE-070605-1 itpr3|OTTDARP00000028408 DKEY-163F12.8-002 LG_ BX784023.10 Danio rerio protein_coding NOVEL, 1319 bp
GCGTGTTTTGACTTGACAAAGTTGCGCGTGCTTCCTGGTT
TGAAGCGCTGTGACCTCAGGTACGCCGCAAAACTCCAACA
ACGAGCCACTTCTGCTGCTCCTCGGACATCTGTGCTCCAC
GCTCCCAGCTGCACACCCGACCAGGGATTACACGTTTGCT
GTTTTCTTCAAAATTCCCAGCTCTGCCGAGATGCATTTAA
ACTTTAACTGTGGCTGAAGCGCGTGCCTCCACCCGCTTTA
TCAGGAAGAGTTTGAGAGTAAAGTGTCCGGGCTTCTTAAG
AACAAACTCAAGCAAGCACCCATCTTCGCATTGAAAGGCA
AAGATGTCCGATTCGGCGTCTAGTTTTCTCCATATCGGGG
ATATTGTGTCCCTGTATGCAGAAGGAACTGTCAATGGTTT
TATAAGCACACTGGGGCTGGTGGATGACCGTTGTGTCGTG
GAGCCTGCAAGTGGAGATTTAGAAAACCCTCCCAAAAAAT
TCAGAGACTGCCTCTTTAAGGTGTATCCCATGAACAGATA
TTCGGCTCAGAAACAGTTCTGGAAAGCCAAACAGGCCAAA
CATGAAAAGGATAAAATTGGAGACATGGTGCTTCTTCAGA
AATTGCAGCATGCAGCTAATTTGGAACAAAAGCAGAATGA
TGCTGAGAACAAAAAGGTCCACGGCGATGTGGTTAAATAC
GGCAGCGTCATTCAGCTGCTCCACATGAAGAGTAACAAGT
ATTTGACAGTAAATAAGCGTCTCCCAGCACTACTGGAGAA
GAATGCAATGCGCGTCACTCTGGATGGGACGGGGAATGAG
GGCTCCTGGCTTTTCATTCAGCCTTTCTGGAAGCTCAGAG
CCAACGGAGACAATGTGGTGGTTGGAGACAAAGTGATCCT
GAATCCTGTGAATGCTGGACAGCCTCTCCATGCCAGCAGC
TATGAGCTTCCCGATCATTCAGGGTGCAAAGAGATCAACT
CTGTGAACAGCAACACCAGCTGGAAGATCAGTCTGTTTAT
GATGTTCAGTGACCACAAAGATGAAGTGCTGAAAGGAGGA
GACGTGGTGAGGCTGTTTCACGCTGAACAGGAGAAGTTTC
TGACCTGTGATGAGTACAAGTCTAAACTGCACGTGTTCTT
GCGCACAACTCTGCGTCAGTCAGCTACTTCAGCCACCAGC
TCTAATGCATTATGGGAAGTGGAGGTGGTCCACCATGATC
CATGTCGAGGAGGAGCCGGACACTGGAACAGCCTCTACAG
ATTCAAACACCTGGCCACAGGAAACTATCTCGCTGCTGAG
GAGAACCCAGGTTACAAAGAAAACAGCAATGATATTGAG

itpr3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA itpr3-201 (1) 7368
itpr3-202 1319
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itpr3-202 Contained in:
OTHER itpr3-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035337 (1)
  • Ensembl_Trans:ENSDART00000144488 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE321726 (1) 905bp
    GenBank:AL906758 (1) 539bp
    GenBank:AL906759 (1) 533bp
    CITATIONS (2)