ZFIN ID: ZDB-TSCRIPT-090929-15977
Transcript Name: itpr3-201
Previous Names: itpr3-001, ottdart00000035338, si:dkey-163f12.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035338 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035338|OTTDARG00000026569|ZDB-GENE-070605-1 itpr3|OTTDARP00000028409 DKEY-163F12.8-001 LG_ BX784023.10 Danio rerio protein_coding NOVEL, 7368 bp
AGAAGCCTTGGAGAAAGGATTAAATATAAGCTAGTCGCAG
TGCCTCATGGGAACGACATCGCCTCTCTGTTTGAGCTGGA
CCCGACAACACTGCAGAAGACTGATTCATTTGTGCCAAGA
AATTCTTATGTTCGATTTCGCCACCTGTGCACGAACACTT
GGATCCAAAGCACCAACATTCCTATCGACATCGATGAAGA
GCGGCCGATTCGATTAATGCTGGGCACGTGCCCCACTAAA
GAGGACAAAGAAGCATTCGCCATCGTCTCTGTGCCGGTCA
TGGAGATTCGAGATCTAGACTTCGCCAATGATGCGAGTCT
CATGTTGAGCACTGTTGTCGAGAAGTTCAAATACGGTTTT
CTCAGTCCTAATGACAGAAGGTATGCCATTAAGCTGCTGG
AGGATGTGGTATTCTTTGTTGTGGATCAACTTAACAATGG
CCAGCCGGCCCTGGAGGTGTCGATGAACAAGCCCAACCGA
GAGAGACAGAAACTGATGAGAGAGCAGAACATTTTAAAAC
AGATATTTGGGATCATTAAAGCTCCGTTCAAAGAGAGGGG
AGATGATCCTCCTCTACTGACACTGGAGGAACTGTCCGAC
CAGAAATACTTATTGTATCAGTACATGCTCAGGCTGTGCT
ACAGGGTGCTGCGTCATTCACAGGAAGACTACCGAAAGAA
TCAGGAGTACATAGCTAAGCAGTTTGGAATGATGCAGTCT
CAGATCGGCTATGATATTCTGGCGGAGGACACCATCACAG
CCCTGCTCCACAACAACCGCAAACTGCTAGAGAAACACAT
CACTAAAACTGAGGTGGAGACATTTGTCAGTCTGGTTCGC
AAAAACAGGGAACCCAGGTTTCTAGACTATCTTTCAGACT
TGTGTGTGTCCAATAATGTAGCAATCCCAGTTACTCAAGA
GCTGATCTGTAAATGCGTGCTGAACGCCAAGAACCAGGAT
ATTCTCATGAAAACAGAGCGGCGAGCAGCTAAGGAAAGTC
AGCACACTTCCGAGTACTTGGAAGAGTTTGGAGACGAGGA
TGAAGTTTGGCTGATCTGGTCTGAAAAGGAAAATGAGAAC
CATGAAAAGAGCATTCGGCAGCTTGCCCAAGAGGCCCGTC
AAGGGAACGTGCATGATGAAAATGTTCTGACATATTACAG
GTACCAGCTGAAGCTGTTCGCACGAATGTGTTTTGATCGG
CAGTATCTGGCCATAGATGTGATCTCAAAGCAGCTGGATA
TAGAGCTAATCTCGCTCTGCATGATGGACGAGACTCTTCC
CTTTGACCTGCGAGCGTCTTTCTGTAGGCTCATGCTGCAC
GCACACGTTGATCGTGACCCTCAGGAGCTTGTGACGCCCA
TCAAGTTTGCCCGCTTGTGGACTGAGATTCCCACCTCTAT
CAGCATCAAAGATTATGACTCTCACTTGGACTATTCACGA
GACAATAAAAAGAACAAGTTTGCTAATACCATGGCTTTCA
TGGAGGAATACCTCAACAATGTGCTCATCGATGACCTGCC
TTTTGCAAACGAGGAGAAAAACAAGCTAACGTATGAGGTG
GTGAGCTTGGCGAGGCATCTCATCTACTTTGGCTTCTACA
GCTTTTTCGAGCTCCTGAGATTGACTCGCACTCTTCTGGG
AATCATAGACTGCACTCCGAGCAACGCTTCCATCAACCCA
CTGTTCAACGATGATGGCAGTAAGAACGTCAGGCGCTCCA
TTCATGGCATGGGACAGATGATGTCTACCATGGTGCTTAA
CCGAAAACCATCTCTGTTCTCCGCTCCTGGTCGAACTGGA
GACAGTCAAGTCGGCAGTAAAGACAGCATCGACACACAAG
ACATCACTGTCATGGACACCAAACTCAAGATTCTGGAGAT
TTTACAGTTCATCCTCAGCGTTCGTCTAGACTATCGGCTT
TCGTTCCTCCTCTCCGTCTTCAAGAAGGAGTTTGTGGATG
TTTATCCTATGGAAGATGCAGATGCCACACATCATACTGA
GCATGAGGCTTCCATCAACCTACAGCACATTGGAGAGCAG
GCAGAGGCCATGTTTGGAATTGGAAACAGCATTCTGGAAG
TGGATGATGAAGGAGGACGAATGTTTCTGCGTGTTTTGAT
CCACCTCATCATGCACGACTACCCTCCATTGGTTTCTGGG
GCCTTGCAGTTGCTGTTCAAGCACTTCAGTCAAAGACAAG
AAGTCCTTCATACTTTTAAACAGGTCCAATTGCTTATTTC
AACTCAGGATGTGGACAACTATAAACACATAAAACGAGAT
CTGGATCTGCTGCGCACCATGGTGGAGAAGTCTGAGCTTT
GGGTCATTAAAAAGAGCAGTTCTGGGGGAGATGGAAAGAA
AGACAAGAAAGACAAAAAAGAGCCTGAAGCGGTGTCACCT
GAGGAGGAGGCTGATTCTAAGAAACAGACAACTGAAAAAA
GCAATGAAAGCTACCAGAATGTTAAAGAGATTCTAGAGCG
ATTGAATAAAATGTGCAGTTCAGGTGTATTTAAGAAGCAA
CAAAGGCTACTGAAGAACATGGGTGCGCACAAAGTTATGC
TGGACCTGTTGCAGATCTCCTATGATCGGAATGACACCAA
AATGCTGGAGATCATCAAGTACACACATCTGTTTCTGCAA
AAGTTCTGCACAGGGAATCTGGAGAACCAGGCTCTCCTCC
ATAAACACCTCAACCTTTTCCTGACACCTAGGCTCCTGGA
GGCAGAAACAATGCAGCAGATTTTCAGCAATAATTTCCAG
CTCTGTTCTGAGATCAGCGAGTCTGTGCTGCATCATTTCA
TACATTGCCTGGCCACACAAGGCCGGCACATTCAGTACCT
CAACTTTCTGCACACCATCATTAAGGCCGAAGGGAAATAT
GTGAAGAAATGCCAAGACATGATCATGACTGAGCTTACTA
GTGCGGGGGATGATGTGGTCGTCCTCTACACGGATGACAC
GTCGTTTAACACCATGGTGGAGCTGATGACCCAGTCGAGG
GAAGGGGTGAAGGACGACAGCCCGCTGCGCTACCATATCT
CTCTGGTGGAGCTGCTGGCTGCATGTGCTGAGGGGAAAAA
CGTCTACACTGAGATCAAGTGCACATCTCTGCTGCCCCTA
GAGGAAATGGTCAAAGTAATCACACATGAAGACTGCATAA
CTGAGGTGAAAATTGCTTATGTGAACTTTGTGAACCACTG
CTATGTGGACACAGAAGTGGAGATGAAGGAGATCTACACC
AGCAACCACATCTGGAAGCTTTTTGAGAACTTCACTGTAG
ATATGGCCAGAGTGTGCTCCAACCGTGAGAAACGCATGTC
AGACCCTGTGCTGGAGAAGTATGTAATTCAGGTCGTTTTA
GACACTGTAACTGCCTTCTTCAGCTCTCCTTTCTCTGAGA
ACAGCACCAGCACGGAGGCTCATCACACCACTGTAAAGCA
GCTGCTGCAGTCCACCATGCGTCTGTTAGACTGTCCATGG
CTACAGCCACAGCAAAAAGTCCAAGTGGAGTCCTGCATCC
GAACACTAGCAGTGACAACCAAGAGTCGCTCTATTCCTCT
GCCAGTGGAGTTGGAGGCTCATGTCAACATGATGTTGAGT
CACAGTAATTCCCTCACATTGTCCCGATCCAGTCACTCCA
ACAAAAGCATGTCACGCTTAACACGGCCTGCCGCTCCCAC
CAACCCCTGGGACTACAAGAACATCATTGAAAAACTACAG
GATATCATTAACACACTGGAGGAGCGTGTGATGCCTTTGG
TGAATGCGGAGCTGTCTGTGCTGGTGGATGTGCTGCATCA
GCCTGAGCTGCTGTTTCTGGAAGGCACCGATGCTCGCTCA
CGCTGTGAATCAGGAGGATTTATTTCTAAATTGATCCAGC
ACACAAAGGCCCTCATGAACTCCGATGAGAAGCTCTGTAT
CAAAGTCCTCAGAACTCTGCAGGAAATGCTCATTCGCGAG
TTGGATTTCGATGAAAAGGGCTTTGCCTTAAGAAAGGTGT
TGCTCCAGAACTACCTCTACAATAACAAAAAGAACATAAA
AGCAGAGCTTGTTGAACACGCAGGAGGTGCAGAGGGCGAG
AGAGACTGGCTAACAGTGGCAGCATTACAGTGTCGCCTGG
ACAAAGAAGGCGGCACCAAACTCTTCACAGACCTCATCAC
CAGCACCAAGAATGAGAAGATCTTCCAGGAGAGCATTCAG
CTCGCTATCTGTCTGCTAGAAGGGGGAAACACAGAGATCC
AGAACTCCTTCTACAAACTCATGATGGGAGACAACAAGTC
TGAGAAGTTTTTTAAAGTGCTGAATGACCGCATGAAGAAC
GCACAGCTTGACATCAAATCCACCGTCTCTGTCAATGTGG
GGGAAATGAGCAACAAAGCCAAAGATGACAAAGATCTGGA
GACTGGTGGCGTATCGTCGTTTGGCCAGCCTGAGCCTCAA
CCTGAACAACAGGAAGTGGAAACAGAAATGGGGCCATCTG
TCACCATCATGAAACCCATCCTGCGCTTTCTACAGCTGCT
CTGTGAGAACCACAATCAGGACCTTCAGAACTTTCTTCGC
ATTCAGAACAACAAAACAAACTATAACCTGGTGTCAGAGA
CTCTGCAGTTTCTGGACATCATGTGCGGCAGCACAACTGG
AGGACTGGGTCTGCTGGGCCTTTACATCAATGAGAACAAT
GTGGAGCTGATCACACAGACCCTGGAGACCCTCACAGAGT
ACTGTCAGGGGCCATGCCAAGAGAACCAGACATGCATTGT
CTCCCATGAGTGCAACGGTATTGACATCATCACAGCTTTA
ATTCTGAATGACATCAGTCCTTTATGTCGATATCGCATGG
AACTGGTGCTTCAGCTCAAGGACAATGCCTCTAAGCTTCT
TCTGGCTCTGATGGAGAGCCGTCATGACAGTGAGAATGCA
GAGAGGATCCTGTTTAATCTTCGACCCAGAGAACTGGTGG
AGCTGATTAAAAAGGCTTATCTGCAAGAGGGTGAGTGTAA
GGAGGGAGAAGTGTCACCACGAGAAGTTGGGCATAACATC
TACATCCTGGCACTACAGCTTGCCCGACACAACAAAGTGC
TACTCACACTGCTTAAACCAGTAAAGAAGATAAAAGAGGA
AGAAGAGGAAAGCATCTCCTCTATGCTCAATCTGAACAAG
CAGCAGGAGGAGGAAAAGGAGGATCCACTAGAGCACTACG
ACCGTCAAACTGCTCAGATTGAGATTGTTCGTGAAGATCG
CAGCATGGAGCAGATTGTGTTTCCTGTTCACCCTATCTGT
GAGTTTCTTACGGAGGAGTCAAAGTTTCGAGTGTTCACCA
CCACGGAGCAGGACGAGCAGGGCAGCAAAGTCACAAACTT
CTTCGAGCAGACCTCCTTCCTCCACAACGAGATGGAATGG
CAGAAAAAGCTTCGCAGCATGCCGGTGCTGTACTGGTTCT
CTCGCAGAATGTCTCTCTGGGGCACCATATCTTTCAACCT
GGCTGTTTTCATCAATCTTATCATCGCTTTGTTTTACCCT
CATGACTCTGGTCATTCTGGTAGCATCGACTCTTCTCTTC
TGCTCATGGGATTCTGGTGTTTTGCTGGACTGGCTGTTTT
AGGCCTGCTATTCAAGCGATATGGGTTTCAGTCACTGACC
GTTGCCATCACGCTGCGCTGCATCTATCACTTCGGTATTG
GTCCGACACTCCTCTTGCTGGGGGCTCTCAATCTCATCAA
TAAGATAGTGTACTTGGTGAGCTTTGTGGGAAACAACGGC
ACCTTCATCATGGGTTATAAAGCCATGGTAATGGATGTAG
AATTCCTGTATCATGTGGCTTACGTGTTAACCAGCAGTCT
GGGGCTGTTTGTCCATGAGTTCTTCTACAGCATATTGCTG
TTTGATCTGATCTACCGTGAGGAGACACTGTTTAACGTCA
TCAAGAGTGTGACCCGTAACGGCCGCTCTATTCTCCTCAC
TGCTGTCCTGGCCATCATTCTGGTCTACCTGTTCTCCATC
GTCGGCTTTCTCTTCCTCAGGAATGACTTCATTATGGAAG
TCGACCACCTTGCTAGCCCAGCTCCAGGAGATACTGAAAG
CTTTATGAGCAGCTGCAGTTCTGATGGAATTGACTGCACA
GAGGAAACTGGTCTCCTTGCTCCAGCTGAAGAAGATGAAG
ACAACACTGAGAGAGCATGTGACACCCTTCTTATGTGTAT
TATTACGGTGCTGAATCATGGGCTGAGGAATGGAGGAGGT
GTAGGAGATGTTCTGCGCAAACCATCTAAGAATGAGCCTT
TGTTTCCCGCTCGTGTGGTGTATGACCTTCTCTTCTACTT
TATTGTCATCATCATTGTTCTCAACTTGATTTTTGGTGTG
ATTATTGACACCTTCGCTGACCTGCGTAGTGAAAAACAGA
AGAAAGAAGAAGTTCTGAAGACCACCTGTTTCATTTGTGG
TCTTGAGAGGGACAAGTTTGACAATAAGACAGTGTCATTC
GAGGAACATATTAAATTGGAGCACAACATCTGGAACTACC
TCTATTTTATTGTGCTGATACGGGAGAAAAACAAGACCGA
TTACACCGGCCCGGAGAGCTATGTGGCTCTTATGATAAAG
AATAAGAACCTGGATTGGTTTCCACGCATGCAGGCCATGT
CTCTGGTTGTAACGGATGGAGATGGAGAACAAAATGAGAT
GAGGAACCTGCAGGATCGTCTTAGCTCCACCATGAAAGTG
GTCACACAGCTCACAAGCCAGTTAACAGAGCTGAAAGAAC
AGATGACTGAGCAGAGGAAGAGGAGACAGCGGATGGGTTT
TGTGGATGTTCAGTCCGGCTCCAACCCTGGGATGCCTGTG
CCTCCTAGTCCTGCTGGAGGAAATCAGGTCTACAAGGCCT
AAACCCTCCAACTCTCCTGCCATTGACTTTCTAGAAGCAA
TAATGTAATCCTGGGATGCTGGTGTACTTTACAATGGGGA
AAGGTTGCGTTTAGCCGTGGAAACTGGTAGATGGGTTGGA
TCTACACACCCTCAAAAGCACTACTGACTTGATATTTTTT
TACATGGCTGAGCGTGCACATATTTTATATATTTAAATAT
ATGAAGTTTTACTTTCTTTTTTAAGAGTGAGCACCTTTTT
TAAAGATATTTGACAGCTTTCTATAGATTTTGTTTGAATG
TATGGATAAATGAAGCATTACTTTATAAGAAGCTGATGTG
TTTTAGATTAATAGTGAGCATTTCTTTTTTTATGCATCAG
CGTCTGGATTTATCCAGAATGAATGTAAGATGATTTGGGG
AAACCACATCATGAATATCTGGGAAAGTCTAAAATTTAAT
GTGGGGTGTATATATAGCATAATATTCTGGATTAAATCAT
GTTTAAAC

itpr3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA itpr3-201 7368
itpr3-202 (1) 1319
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itpr3-201 Contained in:
OTHER itpr3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035338 (1)
  • Ensembl_Trans:ENSDART00000142836 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK030476 (1) 1042bp
    GenBank:EG573886 (1) 910bp
    GenBank:DY565032 (1) 858bp
    GenBank:CT723984 (1) 813bp
    GenBank:AL922491 (1) 539bp
    CITATIONS (2)