Transcript

vil1-202

ID
ZDB-TSCRIPT-090929-15324
Name
vil1-202
Previous Names
  • vil1-003
  • vil1l-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034541 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034541|OTTDARG00000021667|ZDB-GENE-040426-799 vil1|OTTDARP00000027838 DKEY-260N18.2-003 LG_ BX571855.11 Danio rerio protein_coding KNOWN, 802 bp
AAAAGATAGTACCGGAGCCTAACATTCGGCTACCAAGGAC
AGACTCCCTAAAAAAGGTATTTCCCTGAGTCTTAAGCTGG
CACCATGCCACAGGAGGTCAAGACTGACGTTCCCAAAGTC
CTTAATAAAACCACACCAGGACTTCAGATATGGAGAGTGG
AGAACATGGAGCTTGTGCCCTGTCCATCTAAAACATTTGG
ACAGTTTTTTGAGGGAGACAGCTATGTAATTCTCTACACT
CACAAAACCAGCAACAACTTCTCCTATGACATCCATTATT
GGCTGGGAAAGTCCACCTCTCAGGATGAGATGGGAGCAGC
GGCGATTTACACCACGCAGATGGACGACCATCTAGGGGGT
GTTGCTGTGCAACATCGTGAGACCCAGGGCCATGAGAGTG
CCACCTTTCAAGGATACTTCAAACAGGGCATCATATACAA
AAAAGGTGGAGTTGCATCTGGGATGAAACAGGTGGAGACG
AACACATACAACATACGCAGACTTCTGCATGTGAAGGGAA
ATAAGCATGTGGTTGCAGGAGAGGTGGAAATGAGCTGGAA
CAGCTTCAATAAAGGCGATGTGTTCCTGCTGGACCTGGGG
AGTCTGATCATTCAGTGGAATGGGCCTAAGAGTAACCGAA
TGGAGAGATTAAGGGGAATGAACCTAGCCAAGGACATCCG
CGATCGAGAGAGAGGAGGCCGAGCGCAAGTGGCCGTAGTG
GAAGGAGATGATGAGCAATCTTCAGAGGAAGCCATGAAAC
TGATGAAGCAATCCCTGGGCGAGAGGCCGAAAAACATCAA
AG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations