Transcript

vil1-002

ID
ZDB-TSCRIPT-090929-10197
Name
vil1-002
Previous Names
  • vil1l-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027650 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027650|OTTDARG00000021667|ZDB-GENE-040426-799 vil1|no_translation DKEY-260N18.2-002 LG_ BX571855.11 Danio rerio protein_coding KNOWN, 554 bp
AAGTAGAGAGAGGGAGCTGTACAGTCTCCAGCACTGTCTG
AACCAGCAGCACCTTTACCTGGCTGCTTCCTTCTCTATTG
CTCCGGTGGCAGGTATTTCCCTGAGTCTTAAGCTGGCACC
ATGCCACAGGAGGTCAAGACTGACGTTCCCAAAGTCCTTA
ATAAAACCACACCAGGACTTCAGATATGGAGAGTGGAGAA
CATGGAGCTTGTGCCCTGTCCATCTAAAACATTTGGACAG
TTTTTTGAGGGAGACAGCTATGTAATTCTCTACGTAAGTA
TCAGCACAAAGGTACTCAAGTGCTTTGAGTTTGTCAAACC
TCAATGAAGGATGAATGATATGGCTCATTTTCAGACTCAC
AAAACCAGCAACAACTTCTCCTATGACATCCATTATTGGC
TGGGAAAGTCCACCTCTCAGGATGAGATGGGAGCAGCGGC
GATTTACACCACGCAGATGGACGACCATCTAGGGGGTGTT
GCTGTGCAACATCGTGAGACCCAGGGCCATGAGAGTGCCA
CCTTTCAAGGATACTTCAAACAGGGCATCATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations