Transcript

vil1-201

ID
ZDB-TSCRIPT-090929-10196
Name
vil1-201
Previous Names
  • vil1-001
  • vil1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027649 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027649|OTTDARG00000021667|ZDB-GENE-040426-799 vil1|OTTDARP00000022646 DKEY-260N18.2-001 LG_ BX571855.11 Danio rerio protein_coding KNOWN, 3265 bp
ACAGTCTCCAGCACTGTCTGAACCAGCAGCACCTTTACCT
GGCTGCTTCCTTCTCTATTGCTCCGGTGGCAGGTATTTCC
CTGAGTCTTAAGCTGGCACCATGCCACAGGAGGTCAAGAC
TGACGTTCCCAAAGTCCTTAATAAAACCACACCAGGACTT
CAGATATGGAGAGTGGAGAACATGGAGCTTGTGCCCTGTC
CATCTAAAACATTTGGACAGTTTTTTGAGGGAGACAGCTA
TGTAATTCTCTACACTCACAAAACCAGCAACAACTTCTCC
TATGACATCCATTATTGGCTGGGAAAGTCCACCTCTCAGG
ATGAGATGGGAGCAGCGGCGATTTACACCACGCAGATGGA
CGACCATCTAGGGGGTGTTGCTGTGCAACATCGTGAGACC
CAGGGCCATGAGAGTGCCACCTTTCAAGGATACTTCAAAC
AGGGCATCATATACAAAAAAGGTGGAGTTGCATCTGGGAT
GAAACAGGTGGAGACGAACACATACAACATACGCAGACTT
CTGCATGTGAAGGGAAATAAGCATGTGGTTGCAGGAGAGG
TGGAAATGAGCTGGAACAGCTTCAATAAAGGCGATGTGTT
CCTGCTGGACCTGGGGAGTCTGATCATTCAGTGGAATGGG
CCTAAGAGTAACCGAATGGAGAGATTAAGGGGAATGAACC
TAGCCAAGGACATCCGCGATCGAGAGAGAGGAGGCCGAGC
GCAAGTGGCCGTAGTGGAAGGAGATGATGAGCAATCTTCA
GAGGAAGCCATGAAACTGATGAAGCAATCCCTGGGCGAGA
GGCCGAAAAACATCAAAGAAGCCATCCCAGATGAGATCGT
TGATGAGAAACTCAAAACTGCCATTAAGCTCTATCATATT
TCAGATGCGCAGGGGAGCCTTGTAGTGCAGGAAGTGGCAG
TAAAGCCCCTCACACAAGACCTGTTGAAAACTGAGGACTG
CTATCTGCTGGATCAAGGCGGAATAAAGATCTTCATCTGG
AAGGGCAAAAAGGCATCCAAAGCTGAAAGGACAGAGTCTC
TAAAGATGGCAGAAGCCTACGTAAAAGCAAAAGGATATCC
TGTTTCCACCTACATAGAGACGGTGAGCGAGGGAGCAGAA
TCGTCAGTGTTCAAGCAACTCTTCCAGAAATGGACAGACA
AGGGGCAGACAGTTGGAATGGGCACCACACACAATCCGGG
GAAAATTGCGAAAGTTGAGCAAGTCAAGTTTGATGCCACC
TCTATGCATGCCAGACCTGACATAGCTGCACAGCAGAAAA
TGGTGGATGATGGGTCAGGAGAAGCAGAGGTGTGGAGGAT
AGAGGACAATGAGCTCGCCCCTGTGGACAGGAAGTGGCTC
GGTCACTTCTACGGTGGGGACTGTTATCTCATTCTCTACA
AATATGAAGTCAGCAGCAAATTTCACTACATTCTCTACAT
GTGGCAAGGCCGCCATGCATCCACAGCAGAGCTGACAGCC
TGTGCATATCAGGCTGTGATTCTGGACCAGAAATATAATG
GAGAACCGGTGCAGGTCCGCGTTCCTATGGGAAAGGAGCC
CATGCATCTAATGGCCATATTCAAGGGCAAAATGATTGTT
TATGAGGAAGGAAGTTCCAGGGAAGGATCCTCCCAATCTC
GGCCATCAGTTAGATTGTTTCATGTCCATGGTACGAACGA
GTTCAACACACGTGCCACTGAGGTGCCTCCACGCTCATCT
TCTCTGAACTCCAATGATGTGTTTGTGCTCAGCACGGATA
AGTGCTGCTACCTGTGGTATGGCAAGGGCTGCAGTGGAGA
TGAGAGAGAGATGGCCAAATCTCTAGCTGACATTATTTCT
AAAAGGGAGAAGCAAGTCATAGCTGAAGGCCAGGAACCAG
CTGACTTCTGGGTTAATCTAGGTGGAAAGTCCCAGTATGC
TAGCAACAAAAGACTTCAGGATGAAAACATCAGTATCACG
CCCCGGTTGTTTGAGTGCTCCAACCAGACAGGACGCTTCA
TAGCAACAGAGATCACAAACTTCAACCAGGATGACCTGGA
TGAGGATGACGTGATGTTGCTGGACATCTGGGATCAGGTG
TACCTGTGGATCGGAAAAGGTGCCAATGACACAGAGAAGC
GTGAAGCGGTGGTTACAGCACAGGAGTATCTGAAGTCCCA
CCCTGCTGGCCGTGACCTGGATACACCTGTTCTTGTGGTG
AAACAAGGTTTTGAACCACCCACCTTTACAGGATGGTTCC
ACGCCTGGGACCCACAAAAGTGGAGTGAAGGGAAATCTTA
CGACCAGCTTAAAGCAGAGCTTGGGGATGCAACTGATGTT
ATCAAAATTACTGTGGATCTGACCCAACCATCCTCAAACC
AAACCAACTCAAGTAACTCAACTCAAGGAGGTTCGATGCC
CCGTCCTGTAACACAAACCTTTCCTGCAGAGAAGCTGGTG
AACGTTCAGACAGAAGACCTGCCTGAGGGAGTCGACCCCA
CAAGAAAAGAGGACTACCTCTCAGACGATGACTTTGCCCT
GGCCATGGGGATATCTCGGATGAATTTCTATGCCATGCCA
TCCTGGAAGCAACTGAATCTAAAGAAAGAAAAGGGCCTGT
TTTAGGCACAAATGTGCACAAATACATCCCCGTGCCACAA
AACAGACTTGCTCTCATGTTAAACTGTATGAATTCTAGTA
GAGGTGCCATGCAAAAACAACTAAATTTCCTTTTAGAGTT
TTTAAGATGTTTACATATAATTCCTTTATTTAAACATTTC
TCTTTTTTTGCACATGCAAACTGATTTATCTGAAATTGAC
ATATTTAAAGTCAACATTATAAAGCAGAATTAATTACCTT
AGAGTATAACTTTTAAACAGGAAAATGGATGATATTGGGA
AAATGAAGTCTGCAGATCTATCTTTTTTTTTTTACACAGA
TTTGTATTGATGTAGCATGGCGAACTTCCAGTTTAATTTC
CTTTCCTTTTTACTTGCTTTTCCTTAAAGCATCTCAAGAG
GAAACATTTAAGCACTGACAAAAAGCCACGACTCACTGAA
GCGGCTTAAGCACTACAATAAAACTTAATATCTTTGAACT
AAGATGCAAGTTGTATTTGAGATTAATGATTTATAGTGAG
TATTAATTATAAAAGACACCCGGAGACTACTGCACACTGT
CTAATGTGTAATTTCCATTGGTATTAATCATTTACTGTGT
ACAAAAGGCAGACCACCTGTCTAATGGAAAAGTCAATAAA
CATGAAAAGACATTATGATGGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations