Transcript

ncapd2-002

ID
ZDB-TSCRIPT-090929-14423
Name
ncapd2-002
Previous Names
  • si:dkey-175g20.1-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033453 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033453|OTTDARG00000025418|ZDB-GENE-050506-59 ncapd2|no_translation DKEY-175G20.1-002 LG_none CU467875.8,CR788281.7 Danio rerio protein_coding NOVEL, 746 bp
AAATAAGGTGGATTGGTCATAGAAATTCAGGTTTTTAGTA
AGGGAAAAGTCAGGTAATTGCACATTTTTTACAGAATGTG
AACCCTAGATTATGAAGCTGACGTTCTCATTCTTCATCTA
GTGAACTGTGTGAGCTTGGCGCAAGTGCTATCTCTGTGTG
GAGCGGTGGCCTTCTGGCAGGTTTCTCACCTGGAAAGAAG
CGTCAGCTCTGAGCTACGTAGGAGAAGAGGAGAAAAAGAA
GAGAAAGAGGAGAAGGAAAAGGCACCTGCCAGTAAAAAGG
GGGCCAATGACAGCTGTGTTGAGGAGGAGCTCGGTCTGGT
GGGTGCATCAGCTGAAGACACCGAAGCAGAGTTCATTCGC
AAGATCTGTGAAACGGAGTTATTAGCTGAAGGAAACATGT
TGAGTGCGTTTCTGCCTTTGCTGGTGAAAGTTTGCAGCTC
TCCAGGCAAATATTCCCATCCTCAGCTCACCACTGCTGCC
TGCTTGGCTTTGTCTCAGTACATGATGATCAGCCCTGCTG
TTTGTAAAGACCACATCCGACTGCTCTTTACTGTGCTGGA
GAAATCCCAACTTCCTGTTGTCCGAGCCAACACAATTGTT
GCTCTTGGTGATCTAACAGTCCGCTTTCCCAACATCCTGG
AGCCCTGGACACCCAATCTTTACGCCAGGTTGAGTGACGA
GAACGCGTCTGTGCGTCTAACTGCTATCACGGTTTTGACC
CAGCTGGTGCTGAAGGATGTGATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations