header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14422
Transcript Name: ncapd2-201
Previous Names: ncapd2-001, si:dkey-175g20.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033452 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033452|OTTDARG00000025418|ZDB-GENE-050506-59 ncapd2|OTTDARP00000027056 DKEY-175G20.1-001 LG_none CU467875.8,CR788281.7 Danio rerio protein_coding NOVEL, 4412 bp
GGCGCGCTGTGTGAAATTCAAATAAGCTGCGACTCAAACC
GTTCGTTCAGCATAGCCAATTTTCTTCGCAGTACTTTCTC
TGATCAGCACACTTTCGGCGGTCACTTTTTCACGCTGTGC
AGAGATGTCGTGGGATTTTATGGTTCCGGTTTGTTTGGAT
GATCTGGTGAAGTCTGGAGCTGTTAATCAGTATGTGGTTC
AGGATGTGCTCTCTGCTAAACAGCTTCCATCTCACATTAA
TAGTTTCAAAGCAGCAATGAGAAGTCAAGGGCCTCTTAGT
ATCCTGGAACATTTTGACACTGCATACAGCGTTTTAAAGC
ACTGTCGCACAGTCGATGTTGCTGTGAAGGAAGACATACT
GGAGTTGCTGATTCAAGTGGTCAGAGGCCTGTCTGTTTCC
CTGCCAACTCTCCTAATGGCGGGCACTTTGTCAGCTGTGG
ACCGCAAACAGCAGCTCAACGCTGTGAAGATGAGCGTGTT
CCTGCTCTGCAAACTCACAGAAATGCTTGAGAGCGACTCC
AACAGAGAGACTATTGTCACAGCACCCAGCAAGGGTCGTA
AGAAGGATAAAGCGGCTGGAAAAGATCTCTTGCAGTGGGA
CAGTGAAAGAGACACCGTTCTTCAGTGTTTGACTCAACTG
CTGCAGCTGGACATTCGCACACTCTGGAGTCTGTCTCTAG
TGGAGGAGGAGTTTGTCAGCTGCGTGACATGCTGTTGCTA
TAAACTCCTGGAAAACCCCACCATAAGCCACATGAAGAAC
AAGTCTACCAGAGATGCCATCATTCATGTGCTTGGGATCA
TGGTGAAGAAATACAATCACATGTTGGGAGCTTGTGTGAA
GGTTATCCAGCTCTTGCAGCACTTCGAGCAGCTGGCGTCA
GTGTGTGCTCAAGCTGTGGCTGCCTGGAGCACAGAGTATG
GCGTAAAGGCTATCGTTGGAGAGATCATGAGAGAGATCGG
TCAGAAGTCAAGTGAGGAGCTCGCCAGAGAAGGCTCAGGT
GTGAAGGCTTTCTCCAGCTTTCTGTCTGAACTCGGTACTC
TGGTTCCTGAAACCATGATCCCCAACATCAGTGTTCTCCT
GACACATCTGGAAGGAGAGAGTCCGAGCTTGCGTGTGGCT
GTGTGTGAAATTCTCGGTGAGGTTCTGGTCCGGGTTTTGT
CTGGTGATAAGTTGGATGATTCTGCTCGTGCCAGTCGAGA
TCGCTTTCTGGACACGCTGCAGGAGCACATCCATGATGCA
CATTCGCATGTCCGAGCACGTGTTCTCCAGGTCTATACAC
GTATTGTAAACAGCAAGGCCTTACCATTGAGCAGATACAC
TGAGGTTATGGAGCTGACTGTTGGCCGTCTGGGTGATAAG
TCTGTGAACGTGTGTAAAAGCGCTATCCAGCTGCTGGCCG
CCTTCATTGCTCATAACCCTTACAGCTGCAAGCTGAGCAG
TGTAGACCTGAAGAAACCCCTGGAAAAAGAGATGGCCAAA
TTAAAAGAGATGCGAGACGCTCAAGCAGAGCAAGTGCCTG
TTGCAGTCATAACAGCAACTGACCTGTGGGATGCGATGAA
GCCTGAGGTGGAGCTGACTGTGAAGGCACTTCTGGAACCT
GGCAGTGAGGAAGAGGATGATGAAGAGGAAGAAGAAGAAG
CTGCAGAGGGAGATAGAAGTGACAGAGACACTGCTGTCCA
AATCGCTCAGTTTCTCCGAGAAAGCAAATACAAGAAGGCA
GTGGGTCTATGCATGCGAGCTCATTCACTGTTTCCAGAGT
CCTCATTCTTTTCAGATTTGGCTGATTTAAATGCAGAATC
CCTCATCAACACACTTGCAACACTTTTTAAAGGCCCAGAA
GAGGAGACGCCTGAAGCAGTGTCCACTGATGCTCCTCCCA
CACCACAGAAGGAGAGTGAAGGCAGAGAGAGTGAACTGAA
GAAGCAAGAGATGTTGGTTCAGTACTTGAAAGATACAGAG
TGCTTTGCTCTTCAAGTGGAAAGAGCCATCGCTGTTATTA
ACAACATGCTGTACTGGAAAACTACTACAATTGTGCAGGA
AGCAGTGCAGTTCTGCGTTACAGCATTTGAGTTCAGCGTG
GCTGACTCAGTGTGTGGGGTCAGAAAGATGCTGCCTCTGG
TCTGGTCCACTGATGTTACCATCAAAGATGCTGTCATCCA
GGCCTACAGACGTTTGTATCTCAACCCTAATGGTGAAAAC
ACAAGAGCCAAAGCTCACACTCTAGTGGACAGTCTGTCAG
ATCTGATGGTCGATGCTTCTTTGGGGACAATTCAATGTCT
GGAGGAAATAGTGCAGGAGTTTTTCAGCAGCGAGAGCGCC
CTGCAGACTTCAGTGATGCAGGTTTTGTGGGAAAGGTTTT
CTGGTAAACGTGAAACTAAAGCACTTCACAGGAGAGCTGC
AGTTCTTCTGCTGGGCATGGCAGGACGTGCTGAGAGGGAG
GTTGTTCTCAGTAATTTGGACACGCTCTGCTCTGTTGCTC
TGGGTGAGAAGGTTGCTGAAGATTATCTGCTGGCTCGGGA
CACGCTCATCACCATCACTAATATAACAGATCATGTGAGG
CAATCCAAAGGTGTCCCCTTCAGGCTTCCTATGGACCACC
ATCTTTTCAGCTGTCTGTCCCAGGCCATTGCTGATGGAGT
GGTCCAGTCAGACCCCCATTGGCAGACCTTCATGGAACAG
GCCGTTCGTCTGATCTACTTCCTAGCAGAGTCGCCTGACC
AGCTGTGTTCCCGCCTCTTGCAGCGCTCTGCTCGTCTCCT
ATTGGAGCAAATCACAGAGGGTGGTGAACCGGACCAATCG
CAGCTCCAGGAAGGTGCATCTCAGGTTTCTGAGGAACAAG
TGAACTGTGTGAGCTTGGCGCAAGTGCTATCTCTGTGTGG
AGCGGTGGCCTTCTGGCAGGTTTCTCACCTGGAAAGAAGC
GTCAGCTCTGAGCTACGTAGGAGAAGAGGAGAAAAAGAAG
AGAAAGAGGAGAAGGAAAAGGCACCTGCCAGTAAAAAGGG
GGCCAATGACAGCTGTGTTGAGGAGGAGCTCGGTCTGGTG
GGTGCATCAGCTGAAGACACCGAAGCAGAGTTCATTCGCA
AGATCTGTGAAACGGAGTTATTAGCTGAAGGAAACATGTT
GAGTGCGTTTCTGCCTTTGCTGGTGAAAGTTTGCAGCTCT
CCAGGCAAATATTCCCATCCTCAGCTCACCACTGCTGCCT
GCTTGGCTTTGTCTCAGTACATGATGATCAGCCCTGCTGT
TTGTAAAGACCACATCCGACTGCTCTTTACTGTGCTGGAG
AAATCCCAACTTCCTGTTGTCCGAGCCAACACAATTGTTG
CTCTTGGTGATCTAACAGTCCGCTTTCCCAACATCCTGGA
GCCCTGGACACCCAATCTTTACGCCAGGTTGAGTGACGAG
AACGCGTCTGTGCGTCTAACTGCTATCACGGTTTTGACCC
AGCTGGTGCTGAAGGATGTGATGAAGGTCAAAGGTCAGGT
CAGTGAGGTGGCAGTGCTCCTGCTGGACCCTGAGCCTCAC
ATCGCCAGTCTCGCTCTCAACTTCTTCAACGAGCTCTCTG
CAAAGGATAATGCCATCTACAACCTGCTGCCAGACATCAT
TAGCCGACTATCTGATCCTGAACGTGGAATGAATGAGGAG
GATTTCAACACCATCATGAAACAACTGTTCTCCTACATCA
CGAAAGAGAGACAGACTGAGAGCTTAGTGGAAAAGCTCTG
CCAGCGATTCAGAACTGCCAAGACGGAGCGACAGTGGGCC
GATCTAGCCGTGTCTTTGTCACTGCTGTCTGTGTGCGAGA
GAGGTTTTAAGAAGCTGCAGGAGTGCTGGGACTGTTACAG
TGATAAACTAGCTGAGCCTGGAGTCTATCAGCCCCTGCTG
TCCATCGCTGCCAAACTCCGTCGAAGAGCCAAACCACAGT
TTAAGGCTCAGGTTGAAGATTATGAGAAGCGTTTGACTGC
TGTTCACACTAAAGGCCTGGAGAATGTGGAGAATGAGGAG
AGGGAACAGCAAGCAGATACACAGAGCCAGAATCTGCACA
CACCACAGGCACCCAAGAGTGTGCGCAGAACCACGCGAGG
CCGCGGCAAACCCAAGGTGGATGACAGTGACCTCGTAACA
CCAAGAAAATCTCGCGCTCGTCCCAAACCTGCCATCACCT
TCACAAGTGATGAAGAGGAAGAGGAGGATGCTGTCATGGC
AGAGAGCGAGACTCCTAAAGTGACGACACCCATCGCCCGC
ACACGACGCACTCGCCTCAGACACTGAGCACTCTTTTCTG
AATCTGTTTCCAGTCTTTTTATCTCTATTCCGCTTAATAC
GATTTTATGCATATTAATTCTGATGTCCTTTTCTTAAATG
TTTGTTTTATCTGCTGTATGTTTGTTTTATTAAATCTTTT
TAGACCACAAAA

ncapd2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ncapd2-002 (1) 746
mRNA ncapd2-201 4412
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ncapd2-201 Contained in:

OTHER ncapd2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000033452 (1)
  • Ensembl_Trans:ENSDART00000113351 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC133123 (1) 4404 bp
    GenBank:EB777050 (1) 372 bp
    CITATIONS (2)