ZFIN ID: ZDB-TSCRIPT-090929-13728
Transcript Name: mycb-202
Previous Name: mycb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032230 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032230|OTTDARG00000021596|ZDB-GENE-040426-780 mycb|OTTDARP00000026157 mycb-002 LG_ CR391940.14 Danio rerio protein_coding KNOWN, 857 bp
ATTAGTAAATCCAGGAGACGACTGATTGAAGTTGTGTTTA
GGATGATTAACATTTGTGTTAACATTTAAAGAGCGAGACT
TTAACCATGCCTTCTTCTTCACAGGCACTCACCATGCCGC
TGAATTCAAGTATGGAGTGTAAAAATTATGATTACGACTA
CGACTCCTACCAGCCCTATTTCTATTTTGACAACGAGGAC
GAGGATTTCTATAACCATCAGCACGGACAGCCACCGGCGC
CCAGTGAGGATATATGGAAGAAATTTGAACTGCTGCCCAC
CCCTCCGCTCTCCCCGAGCCGGCGACCCTCCCTGTCAGAC
CCCTTCCCGTCCACAGCCGACAAGCTCGAGATGGTGTCGG
AGTTTTTGGGGGACGATGTGGTCAACCACAGCATTATTTG
TGACGCGGACTACTCCCAGTCGTTTCTGAAATCGATTATC
ATTCAGGACTGTATGTGGAGCGGTTTCTCCGCAGCGGCTA
AGCTGGAGAAGGTGGTGTCGGAGAGATTAGCGTCGCTCCA
GGCGGCGAGGAAGGAGTCATCCAGGACCGAGTCCGCGGAC
ATCTGTCGGTCTGTCGGCTTCCTCCAGGACATGAGCACCC
CTGCCTCCCAGTGCATTGACCCGTCCGTGGTGTTTCCCTT
TCCACTGACGGACAGCACAAAGCCGTGCAAACCCGCGCCC
ACGCCGGCTTCCACAACACTTCCACTGGATACTCCGCCAA
ACAGTGGGAGTAGCAGCAGCAGTAGTGACAGCGAATCCGA
TGACGAAGATGATGAAGATGAAGAAGAGGAGGAAGAAATT
GACGTGGTCACGGTGGAAAAGAGAAAGTCGGTGAAAAAGT
CTGACGCGAACGCAACG

mycb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mycb-201 (1) 1718
mycb-202 857
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mycb-202 Contained in:
[BAC] DKEYP-106C5 (1)
OTHER mycb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032230 (1)
  • Ensembl_Trans:ENSDART00000135040 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH506520 (1) 882bp
    CITATIONS (2)