header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10083
Transcript Name: mycb-201
Previous Name: mycb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027530 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027530|OTTDARG00000021596|ZDB-GENE-040426-780 mycb|OTTDARP00000022551 mycb-001 LG_ CR391940.14 Danio rerio protein_coding KNOWN, 1718 bp
AAACCCGCGGGAGCAGCTGTTCGAAATCTTGCAGTAAATG
ACAAGCAGCCGCACGGGTGCTGCAGAAGTGCGCAGGTTCA
GCGGCGCGACCCACTCCCACTTTTGGACTTACTTTCACTT
GATAGTTCACGCTCACGCTGACATCTGACCATATTGTCAG
TGTTCATTCAGCTTTTACCACGGCTACGGCACTCACCATG
CCGCTGAATTCAAGTATGGAGTGTAAAAATTATGATTACG
ACTACGACTCCTACCAGCCCTATTTCTATTTTGACAACGA
GGACGAGGATTTCTATAACCATCAGCACGGACAGCCACCG
GCGCCCAGTGAGGATATATGGAAGAAATTTGAACTGCTGC
CCACCCCTCCGCTCTCCCCGAGCCGGCGACCCTCCCTGTC
AGACCCCTTCCCGTCCACAGCCGACAAGCTCGAGATGGTG
TCGGAGTTTTTGGGGGACGATGTGGTCAACCACAGCATTA
TTTGTGACGCGGACTACTCCCAGTCGTTTCTGAAATCGAT
TATCATTCAGGACTGTATGTGGAGCGGTTTCTCCGCAGCG
GCTAAGCTGGAGAAGGTGGTGTCGGAGAGATTAGCGTCGC
TCCAGGCGGCGAGGAAGGAGTCATCCAGGACCGAGTCCGC
GGACATCTGTCGGTCTGTCGGCTTCCTCCAGGACATGAGC
ACCCCTGCCTCCCAGTGCATTGACCCGTCCGTGGTGTTTC
CCTTTCCACTGACGGACAGCACAAAGCCGTGCAAACCCGC
GCCCACGCCGGCTTCCACAACACTTCCACTGGATACTCCG
CCAAACAGTGGGAGTAGCAGCAGCAGTAGTGACAGCGAAT
CCGATGACGAAGATGATGAAGATGAAGAAGAGGAGGAAGA
AATTGACGTGGTCACGGTGGAAAAGAGAAAGTCGGTGAAA
AAGTCTGACGCGAACGCAACGCATCAAAGCCCGGTCGTCC
TCAAGCGGTGTCACGTTAACATTCACCAACACAACTACGC
CGCCCATCCGTCCACGCGGAATGAGCAGCCTGCAGTCAAG
CGGATTAAATTCGAGAGCCACATCCGGGTGTTTAAACAAA
TTAGCCATAACCGAAAATGCGCGAGTCCCAGGACGTCGGA
CTCTGAGGATAACGATAAGCGGAGGACTCATAATGTGCTC
GAGCGGCAGCGGCGGAACGAGCTCAAACTGAGCTTCTTCG
CGCTGAGGGACGTCATTCCTGACGTGGCGAACAACGAGAA
AGCGGCCAAAGTGGTGATCCTGAAGAAGGCGACGGAGTGC
ATAGCGAGCATGCAGGAGGATGAACAAAGACTGATCTCAC
TTAAGGAGCAGTTGAGGAGGAAATGTGAACATTTGAAACA
GAGACTCGAGCAGTTGAGCTGTTCTTAAGCTGCCTGGACT
TAATTTATGAACTTGTTTTATGCATCCTTGTATGGTTATG
CCATGAGTCGATACAAGGTCTGGCGAGGGTGTGGCAAAGT
AGTGAGCAATCTTGCATTGATTTATACAATTCACACTGCC
TCAATTTGAACGCGATAGAGGTTGAATTTATTTGTATTTA
ATTTTATTTTTTAGTATTAACATGGTCTATGGTTTCATTT
TACTGTTGGCCTTAACTTAATGCTTTTTTGTAAGTTTTGT
ACATAATGCACATATGTATTCAAGATTCTGTTGATTTCTT
AAATGTGTTTCTCTATAAAGTTGTGTTTTTTTGACTAA

mycb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mycb-201 1718
mycb-202 (1) 857
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mycb-201 Contained in:
[BAC] DKEYP-106C5 (1)

OTHER mycb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027530 (1)
  • Ensembl_Trans:ENSDART00000005143 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045424 (1) 1753 bp
    GenBank:DN770346 (1) 793 bp
    CITATIONS (2)