Transcript

dnajc1-004

ID
ZDB-TSCRIPT-090929-13451
Name
dnajc1-004
Previous Names
  • zgc:152779-004
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031821 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031821|OTTDARG00000024314|ZDB-GENE-061103-529 dnajc1|no_translation dnajc1-004 LG_ CR388093.11 Danio rerio protein_coding KNOWN, 653 bp
GATGATCACAGTCAGCTCTCCCGTTGTATGGCCAAGTTTC
CCGGTGGAACACCAGGACGGTGGGAGAAGATAGCTCATGA
ATTGGGCAGATCAGTGTCTGAGGTGACTGCAAAAGTCAAG
CAAATCAAGGACTGTGTCACCAATACATCGGGGTTAGTGA
AGTTCTCTGAACTGAAAGGTGGTGCGGTGATTGGAAAAAG
CTCCAAAGCCATTACAGTGCCGGACAGTCTGATGACCCAG
AGAGAGGAGCCTGTAGAGCAGCCGCTGGAGGATTCAGGAG
AGCCCGAAGACTCCGAGAGCAAGGCACTCAGAAGACGGGC
TAAAAAGTCTGCATCCGGGAGCACTGGAGCAGCGGAGGAG
AGGATGAAAGGGCGCAGACAAAGAGACTTCGACCCTACAG
CTGTGGATGAAGACAGTGAATATGAGAAGAAACCATCAGC
TCCCAAAGAAAAAGCTGGTGCTGCTGAAGACGTCTGGACA
CAGAACCAGCAGAAGCTCTTGGAGCTGGCTTTACAGCAAT
ACCCACGTGGCACCACTGAACGCTGGGACAAGATTGCTAA
AGTGGTGCCTGGAAAAACCAAGGTAAGTATCAGACCAATC
AGCCACAGTCGTCAGTATGAACCATTGTTTAATAAAAGGT
AATACAATTAGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations