ZFIN ID: ZDB-TSCRIPT-090929-13451
Transcript Name: dnajc1-004
Previous Name: zgc:152779-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031821 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031821|OTTDARG00000024314|ZDB-GENE-061103-529 dnajc1|no_translation dnajc1-004 LG_ CR388093.11 Danio rerio protein_coding KNOWN, 653 bp
GATGATCACAGTCAGCTCTCCCGTTGTATGGCCAAGTTTC
CCGGTGGAACACCAGGACGGTGGGAGAAGATAGCTCATGA
ATTGGGCAGATCAGTGTCTGAGGTGACTGCAAAAGTCAAG
CAAATCAAGGACTGTGTCACCAATACATCGGGGTTAGTGA
AGTTCTCTGAACTGAAAGGTGGTGCGGTGATTGGAAAAAG
CTCCAAAGCCATTACAGTGCCGGACAGTCTGATGACCCAG
AGAGAGGAGCCTGTAGAGCAGCCGCTGGAGGATTCAGGAG
AGCCCGAAGACTCCGAGAGCAAGGCACTCAGAAGACGGGC
TAAAAAGTCTGCATCCGGGAGCACTGGAGCAGCGGAGGAG
AGGATGAAAGGGCGCAGACAAAGAGACTTCGACCCTACAG
CTGTGGATGAAGACAGTGAATATGAGAAGAAACCATCAGC
TCCCAAAGAAAAAGCTGGTGCTGCTGAAGACGTCTGGACA
CAGAACCAGCAGAAGCTCTTGGAGCTGGCTTTACAGCAAT
ACCCACGTGGCACCACTGAACGCTGGGACAAGATTGCTAA
AGTGGTGCCTGGAAAAACCAAGGTAAGTATCAGACCAATC
AGCCACAGTCGTCAGTATGAACCATTGTTTAATAAAAGGT
AATACAATTAGGA

dnajc1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnajc1-201 (1)    Ensembl 2113
ncRNA dnajc1-002 (1)    Ensembl 617
dnajc1-003 (1)    Ensembl 752
dnajc1-004 653
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc1-004 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031821 (1),  Ensembl_Trans:ENSDART00000147726 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DY557502 (1) 678 nt
CITATIONS (2)