ZFIN ID: ZDB-TSCRIPT-090929-13448
Transcript Name: dnajc1-201
Previous Names: dnajc1-001, zgc:152779-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031818 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031818|OTTDARG00000024314|ZDB-GENE-061103-529 dnajc1|OTTDARP00000025848 dnajc1-001 LG_ CR388093.11 Danio rerio protein_coding KNOWN, 2113 bp
ACTAGATCTTTCGTGCTTATTGGCTCGCGCTGTGGCGGCT
GCATGTGAAAGCGCACACGTACAGCAGGCTGAGCTCAAGC
TATGGGCCTGTCTGAGCTAAAAGACGGGAGGTTAGGCTGA
TATCCTCTCGAAATCAAGGGTCTCCAAATGGATAGTGGGT
GGTAAACCTTCGCGAATATAGCCTACAAAATCAGACATGG
CTTTGCCCGGGATCATTGCGGTAGCGTTGTTCTCCGGGCT
GCTCGTGATTCAGCCAACGCCGACGTTAGCATGGGACGCA
GACCTGGAGCTTTTCGACCTAGTGGAGGAAATCCCTCAAA
CATTTTACGAGTTCCTGTCGGTTAATCAGGATGCATCCTC
TTCTGAGATCAGGAAGGCATATAGAAAGCTTTCTCTTATT
TTGCACCCTGATAAAAACAAAGATGAAAATGCAGAAAACC
AGTTTCGACAGTTAGTTGCCATCTATGAAGTTCTCAAGGA
CGAGGAAAGAAGGCAAAGATATGATGACATCTTGGTTAAT
GGGCTGCCAGATTGGAGACAGCCTGTCTTCTACTACCGAC
GTGTTAGGAAGATGAGCAATGGAGAGTTGGGCTTCCTCCT
CTTCCTCATCCTGACCGTGGGTCACTATGCGGTTATATGG
TCCATCTACCTTGAAAAGCAGTTAGATGAACTTCTGAGCA
GGAAGAAGAGGGAGAAGAAAAAGAAGCAAACCAGCAAAAT
GACAGATGAGATGAAGCCTTTGGCTCAGGACAAAAATGAG
AGATCTGACAGGCCACACTGGCATGACATTTTACCTCTCA
AATTAAGCATCTGGTTGTATTATTCAATAAAGTCTCTCCC
TCATATCATACAGGATGTGAAGCAGTATTATAAAGATTAT
AAGGAAATGAAAGTAAAGGAGAAGGAAGAGGCAGAAGCTC
TGGCAGAACAGGAAATGCAGCAGAAAGAAAAACGGCCCAA
AGTGAAAAAAACGAAAGTGGAGTTTCCAGTCTATGAACCC
AGTGCAAATGCAGCTTTCGCTCTAGCATATGATCAAGGAA
CATCTATTGAAGAAATTGAAGATCAGATGGATGACTGGTT
GGAAGACAAAAAACAGCTGAAGAAGAAAACACAAGAGTGG
ACAGAGGATGATCACAGTCAGCTCTCCCGTTGTATGGCCA
AGTTTCCCGGTGGAACACCAGGACGGTGGGAGAAGATAGC
TCATGAATTGGGCAGATCAGTGTCTGAGGTGACTGCAAAA
GTCAAGCAAATCAAGGACTGTGTCACCAATACATCGGGGT
TAGTGAAGTTCTCTGAACTGAAAGGTGGTGCGGTGATTGG
AAAAAGCTCCAAAGCCATTACAGTGCCGGACAGTCTGATG
ACCCAGAGAGAGGAGCCTGTAGAGCAGCCGCTGGAGGATT
CAGGAGAGCCCGAAGACTCCGAGAGCAAGGCACTCAGAAG
ACGGGCTAAAAAGTCTGCATCCGGGAGCACTGGAGCAGCG
GAGGAGAGGATGAAAGGGCGCAGACAAAGAGACTTCGACC
CTACAGCTGTGGATGAAGACAGTGAATATGAGAAGAAACC
ATCAGCTCCCAAAGAAAAAGCTGGTGCTGCTGAAGACGTC
TGGACACAGAACCAGCAGAAGCTCTTGGAGCTGGCTTTAC
AGCAATACCCACGTGGCACCACTGAACGCTGGGACAAGAT
TGCTAAAGTGGTGCCTGGAAAAACCAAGGAGGAGTGCATG
TGCCGTTTCAAACTGCTGGCAGAGTTGATTCAGAAACGGA
AGCAGGCCAAGAGTTGACTGCTGCTCTTCAGTGTTTCACC
ATACCTCTCACCTGCTTTTATGTGCCTTAATGCGACCCTT
TGTCCTGTTGTGAGACTACGTGCCATGAAACATCAGCATT
AATCATTGAAGAGATCTAAATGCACATTTAAAAAGGTTTT
ATTTATTTTAGAATCCATTTCAGAGTCAGATTTTTCTTTT
CTTTTCTTTTTTTTTTTTTGGTTCTCTATGCAACCAGAAA
ATGTGAGGAGCTGAAGATGCGTGTTTTAATGTTGTTTTCC
CCCTTATTTGGATGTTTTTCAGAAGTTGTGCTGGAATCAT
TTTGGTCATGTTACATAAAGGATTTGCATACAA

dnajc1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnajc1-201 2113
ncRNA dnajc1-002 (1)    Ensembl 617
dnajc1-003 (1)    Ensembl 752
dnajc1-004 (1)    Ensembl 653
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031818 (1),  Ensembl_Trans:ENSDART00000079518 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC125818 (1) 2069 nt
GenBank:BC109461 (1) 1066 nt
GenBank:BC090518 (1) 935 nt
GenBank:EH505917 (1) 910 nt
CITATIONS (2)