Transcript

dnajc1-201

ID
ZDB-TSCRIPT-090929-13448
Name
dnajc1-201
Previous Names
  • dnajc1-001
  • zgc:152779-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031818 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031818|OTTDARG00000024314|ZDB-GENE-061103-529 dnajc1|OTTDARP00000025848 dnajc1-001 LG_ CR388093.11 Danio rerio protein_coding KNOWN, 2113 bp
ACTAGATCTTTCGTGCTTATTGGCTCGCGCTGTGGCGGCT
GCATGTGAAAGCGCACACGTACAGCAGGCTGAGCTCAAGC
TATGGGCCTGTCTGAGCTAAAAGACGGGAGGTTAGGCTGA
TATCCTCTCGAAATCAAGGGTCTCCAAATGGATAGTGGGT
GGTAAACCTTCGCGAATATAGCCTACAAAATCAGACATGG
CTTTGCCCGGGATCATTGCGGTAGCGTTGTTCTCCGGGCT
GCTCGTGATTCAGCCAACGCCGACGTTAGCATGGGACGCA
GACCTGGAGCTTTTCGACCTAGTGGAGGAAATCCCTCAAA
CATTTTACGAGTTCCTGTCGGTTAATCAGGATGCATCCTC
TTCTGAGATCAGGAAGGCATATAGAAAGCTTTCTCTTATT
TTGCACCCTGATAAAAACAAAGATGAAAATGCAGAAAACC
AGTTTCGACAGTTAGTTGCCATCTATGAAGTTCTCAAGGA
CGAGGAAAGAAGGCAAAGATATGATGACATCTTGGTTAAT
GGGCTGCCAGATTGGAGACAGCCTGTCTTCTACTACCGAC
GTGTTAGGAAGATGAGCAATGGAGAGTTGGGCTTCCTCCT
CTTCCTCATCCTGACCGTGGGTCACTATGCGGTTATATGG
TCCATCTACCTTGAAAAGCAGTTAGATGAACTTCTGAGCA
GGAAGAAGAGGGAGAAGAAAAAGAAGCAAACCAGCAAAAT
GACAGATGAGATGAAGCCTTTGGCTCAGGACAAAAATGAG
AGATCTGACAGGCCACACTGGCATGACATTTTACCTCTCA
AATTAAGCATCTGGTTGTATTATTCAATAAAGTCTCTCCC
TCATATCATACAGGATGTGAAGCAGTATTATAAAGATTAT
AAGGAAATGAAAGTAAAGGAGAAGGAAGAGGCAGAAGCTC
TGGCAGAACAGGAAATGCAGCAGAAAGAAAAACGGCCCAA
AGTGAAAAAAACGAAAGTGGAGTTTCCAGTCTATGAACCC
AGTGCAAATGCAGCTTTCGCTCTAGCATATGATCAAGGAA
CATCTATTGAAGAAATTGAAGATCAGATGGATGACTGGTT
GGAAGACAAAAAACAGCTGAAGAAGAAAACACAAGAGTGG
ACAGAGGATGATCACAGTCAGCTCTCCCGTTGTATGGCCA
AGTTTCCCGGTGGAACACCAGGACGGTGGGAGAAGATAGC
TCATGAATTGGGCAGATCAGTGTCTGAGGTGACTGCAAAA
GTCAAGCAAATCAAGGACTGTGTCACCAATACATCGGGGT
TAGTGAAGTTCTCTGAACTGAAAGGTGGTGCGGTGATTGG
AAAAAGCTCCAAAGCCATTACAGTGCCGGACAGTCTGATG
ACCCAGAGAGAGGAGCCTGTAGAGCAGCCGCTGGAGGATT
CAGGAGAGCCCGAAGACTCCGAGAGCAAGGCACTCAGAAG
ACGGGCTAAAAAGTCTGCATCCGGGAGCACTGGAGCAGCG
GAGGAGAGGATGAAAGGGCGCAGACAAAGAGACTTCGACC
CTACAGCTGTGGATGAAGACAGTGAATATGAGAAGAAACC
ATCAGCTCCCAAAGAAAAAGCTGGTGCTGCTGAAGACGTC
TGGACACAGAACCAGCAGAAGCTCTTGGAGCTGGCTTTAC
AGCAATACCCACGTGGCACCACTGAACGCTGGGACAAGAT
TGCTAAAGTGGTGCCTGGAAAAACCAAGGAGGAGTGCATG
TGCCGTTTCAAACTGCTGGCAGAGTTGATTCAGAAACGGA
AGCAGGCCAAGAGTTGACTGCTGCTCTTCAGTGTTTCACC
ATACCTCTCACCTGCTTTTATGTGCCTTAATGCGACCCTT
TGTCCTGTTGTGAGACTACGTGCCATGAAACATCAGCATT
AATCATTGAAGAGATCTAAATGCACATTTAAAAAGGTTTT
ATTTATTTTAGAATCCATTTCAGAGTCAGATTTTTCTTTT
CTTTTCTTTTTTTTTTTTTGGTTCTCTATGCAACCAGAAA
ATGTGAGGAGCTGAAGATGCGTGTTTTAATGTTGTTTTCC
CCCTTATTTGGATGTTTTTCAGAAGTTGTGCTGGAATCAT
TTTGGTCATGTTACATAAAGGATTTGCATACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations