ZFIN ID: ZDB-TSCRIPT-090929-13449
Transcript Name: dnajc1-002
Previous Name: zgc:152779-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031819 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031819|OTTDARG00000024314|ZDB-GENE-061103-529 dnajc1|no_translation dnajc1-002 LG_ CR388093.11 Danio rerio protein_coding KNOWN, 617 bp
CTGCATCCTGTAACAGTATAAACAGCTGGATGCATCCTCT
TCTGAGATCAGGAAGGCATATAGAAAGCTTTCTCTTATTT
TGCACCCTGATAAAAACAAAGATGAAAATGCAGAAAACCA
GTTTCGACAGTTAGTTGCCATCTATGAAGTTCTCAAGGAC
GAGGAAAGAAGGCAAAGATATGATGACATCTTGGTTAATG
GGCTGCCAGATTGGAGACAGCCTGTCTTCTACTACCGACG
TGTTAGGAAGATGAGCAATGGAGAGTTGGGCTTCCTCCTC
TTCCTCATCCTGACCGTGGGTCACTATGCGGTTATATGGT
CCATCTACCTTGAAAAGCAGTTAGATGAACTTCTGAGCAG
GAAGAAGAGGGAGAAGAAAAAGAAGCAAACCAGCAAAATG
ACAGATGAGATGAAGCCTTTGGCTCAGGACAAAAATGAGA
GATCTGACAGGCCACACTGGCATGACATTTTACCTCTCAA
ATTAAGCATCTGGTTGTATTATTCAATAAAGTCTCTCCCT
CATATCATACAGGATGTGAAGCAGTATTATAAAGATTATA
AGGAAATGAAAGTAAAGGAGAAGGAAGAGGCAGAAGCTCT
GGCAGAACAGGAAATGC

dnajc1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnajc1-201 (1)    Ensembl 2113
ncRNA dnajc1-002 617
dnajc1-003 (1)    Ensembl 752
dnajc1-004 (1)    Ensembl 653
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc1-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031819 (1),  Ensembl_Trans:ENSDART00000123008 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK685496 (1) 623 nt
CITATIONS (2)