Transcript

chd7-003

ID
ZDB-TSCRIPT-090929-13421
Name
chd7-003
Previous Names
  • si:ch211-197o6.2-004
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031787 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031787|OTTDARG00000024291|ZDB-GENE-070912-179 chd7|no_translation chd7-003 LG_ CR450710.5 Danio rerio protein_coding KNOWN, 494 bp
TTTTGCTTCAACAGGAGCTTTCTGACGGGACCAAAGCTTT
TGTGGATGGACGGACACATTTAGCGATGCCGTCTCCTGCA
CAGAAGGCCTCTGGTGAAGGTCTAGATGAGGGAAGTCTTC
AAGGAGAAGATGGATCCAGCACTAAGGACCTGCGGGAATG
GCTTAGACAACACCCCACATACACCATGGATATGCCTGGA
TACGTACCAAAGAATGAGGACCTCCTCCTCTCGCAGTTTG
CCAAGCCTAAACAAAAGAGGCACAGATGCCGCAATCCCAA
CAAGATCGACATTAACACGCTGACCGGGGAGGAGAGGGTC
CCTGTTGTTAACATAAGGAATGGAAGAAAGATGGGTGGAG
CCATGGCCCCTCCAATGAAGGATTTACCACGCTGGCTAGT
TGAAAATCCAGAGTATGCCATAGCCCCAGACTGGACAGAT
ATTGTGAAGCAGTCGGGTTTTCTGCCAGAGTCTATGTTTG
ACCGTCTTCTGACG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations