Transcript

chd7-203

ID
ZDB-TSCRIPT-090929-13420
Name
chd7-203
Previous Names
  • chd7-001
  • si:ch211-197o6.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031786 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031786|OTTDARG00000024291|ZDB-GENE-070912-179 chd7|OTTDARP00000025828 chd7-001 LG_ CR450710.5 Danio rerio protein_coding KNOWN, 10963 bp
CACGCGCACGCATGTTTATCCAGTAAGAGTCATGCACGCG
CCCCCTGCCTGTGGAAGGTGAGCGAGCGCGAGTGTCTAGA
GGAGAGGACACGAGAACGCGACTGCCCGGATCGATCGGAT
TAAACTCGAATTGAGTGAAATTAACACAAAGGAGAGAAGC
AGAGTCAGCGAGGACGGGACGCTGAGACGCCGACTTCATC
GGCACTATTTGAATTTCGACAGTTATTCGCGTATTTAAAC
GGATTTTCTGGATATACGAAGAGGAGTTAATTGGCGAAAA
CCCTAAACTGACCCGCGTTGAGTTGGGTCCTGTAACCTGA
CTTCGCCTGACGCTGCGTTCTCTGAGAGAATTAAGGAAAT
ATGGAGTGACATGTTGCAGATTAGTTAGCGGATTAGCGGA
TTTGAGGACATCCACCTCTGTGTGAGCACACATTCCCTGT
CCTGCTTCTGAAGCTTGGCTGCACAGCAGGAGCACTGCAG
CCATGGCTGACCCAGGCATGATGAGCCTCTTCGGAGATGA
TGGGAATCTGTTCTCTGATGAGTTGGAGGGCCTAGGGGAC
TGTGGCTACCCTCAAGGTCAGACAAATCCTATGAGTCAAC
AGATGCCCCATGAGCACCAAGGCTATGGGCAGCTTCCTCC
TTCTCTTCACCTCTCCTCACCTGCAGTCCCTGGACAGGCT
AAGCTTGGCCACCATTTTGACCCCTTTAATCAGTACGAGC
AACCCAAGATGCATCCAATGGACCAGCAAGGGGGTCGGAT
GATGGGGAATGGACCAGTGAATGGCATGTCCTCCCCACAT
TCCCGATATCATGGTGCTCAGGCAGGTGCTGGAGGTGCTG
CAGGGCATCATGTTTACCCAGGTGCGCAAGGAGATGGACG
GAGCCAATCTTTCCCAGACAGCGGAAATACATGGGGTGCT
CAACCAATGCAGGTGCCTGAACAAACTAGACCCCCCTTTC
AGCAGCAACCCCCTCAAGCCTCGTCTCATCAGCATGGCCC
TGCTGGACCACAAGGACATGCCCACCAAATGGGCCCTTTT
ATTGGCCGTGGTGACTATGCCATACAGGGCCACAACCAGA
CCCAAACACCTCCCAGAATGAATCACTTTCCACAAGGCCT
CCCTCAGGAAGCCAATCATTTTTTGGGTCACGTGGGTATG
ACTCAGAATCCTGGCATGTCGGGACCCCCCATACGTCACC
TAGCACAACCTTCTCAGCAGCATCAGCAGCCCAATCAGCA
GTTTCTCCACAGGCCTGGCCAGGGTCCGGTTCATCCAGAT
TCTGTTGCGAGCCACAACCCCCAGTTCCCACAAAGCCCTT
CACGACAGCAACAGCAGCAGCAGCAAGTGATGGGTGGAAG
ACCCCACCAAAACATGGGATTTAACATGCACAACCAGCAA
GTTCCTTCCAACACCGTAAACAGCTCAGGGCAGTACCCTC
CCTATTCTTCATATGGCAACCTTAATCAGGGATTAGCCAA
CACATCAGGGATGAGTCCCAACTTGAGCCTTACCACCAGC
AGTAACAGCAACCCTAATGCTCCTGTGACCCAGGTGCAGC
GCTACCCTGCTCCGGCAGGGCCTCAGCGCTACCCTACACC
TGGGGGTCAACAGGGACCATTGCACCAGCAGCCCATTCAT
GTGAACCAAATCAATACCCAGCCTATGCATCCAGCTCAGA
ACCAGGCTACAGCCCAGCCGAAGCTGCAGCAACATCTACC
ACCTCCACCTCAGGGATCATACTCCTCCCCTCCTTCCATG
TCGCCCATGAGGAATTTAGCCACCCCTGCAGGCACTCCAC
CTCCCCAGCAGGTACGCCCTCCCAGTGCAGGTTTGGCTAC
CGATGTGGGTGGTTACCCCGGAGTACCACATCAGTCTCAA
GGCCCAATGGCTCATGCCCAGAGGGGAGCTGGCCCAATGA
ACGCAGCACAGCCACTTCCCCACCAGCAGCTGCCATCACA
TTCTACACACCCTCATCCTCCAACAACCCAGATGTACGCT
GCTTTGTCACCCAATCACAGAGCTACAGCTGCACAAGGAA
GATCTTCAACAACACCGGGTGGAAACCACACAGAACCACC
AGGCCCACAGGACCAGAGGCTACATGCCCAACAAGCACAG
TGCCAGCAGCTGCAAAAGCCCCCATTGCCTTTCCAGCAGC
AACAGCTGCAGCAGGTGCACACCCCTCCTTCAATTCCTCC
ATCACAGACACACCTGGCTGCACACCACCAGAGCTCCCCT
CCGTCTCAGCAGGCGTGGGCACCTACTCACCAATCACCTC
CACCCATGCAGAAAGTGCCTCACATGCTGCATTCTCCACC
AGACCCTTCCCTGGAGATTATAACATCTAGTAAGACACCT
GCCATGGGCCCAAACCTCCAACCAGCCAACTGTGACCTAC
AGCAGAAGGAGAGCGAGCTCAAGCCAAAAAAGAAGAAAAA
GAAGAAAGCCAAGGTGAGTGAAGGCCAGGAGTGTAATAAC
ATTAGCAGTGAGGCTGGAGGAGAGGTGACTGCTCTGATGA
ATGAGGGAGACTCCCTTATCACTCCTGTGGAGAAGCCAGC
TGAGAAAAAGAGTAAAAAGAAACCAAAGGAGAAGGAGCCC
AAGGAACCGAAAGAGCCCAAGACTCCCAAAACTCCGAAGA
CTCCCAAGACACCCAAAGAACCCAAGGAACCTAAGGAGAA
AAAAGTGAAGACTGCCACGCCGAAGCCTAAGAGCTCCAAA
AAGCCCAGTGCTAAAAAGTCTGACTCTGAGTCCGGTAACA
GCACCAAGAAAGAGGCAAAGCGTAAGAGAGAGCCCTCAGT
CACCTCTGATGTGGAGAAAACACCACCACAGTCACCAGAG
GAGGAAGATGATGATGGTGTTCAGAAGAGACGATCTAGTC
GGCAGGTGAAGAGGAAGCGATATACTGAAGATCTTGAATT
TAGAATTTCAGATGACGACGATGGAGATGATTCTGCAGGA
CCAAAGTCTCCAACTACATCTGAGCAGCAGGAGTTGCCGG
ATGCGGAAGGTCCTGTGGTGGAGAAGATCATGGGGATGCG
AATGGGAAAGAAAGAGTTGGCGTCTGGTGAAGAGATAGAA
GTCGAAGAGTTTTACGTCAAATTCAAGGGCTTCTCTTACT
TGCATTGTCGCTGGGCAGACATTGAAGAGCTGGAGAAGGA
TAAGAGAATCCAGCAGAAGATCAAGAGGTTCAGGGCTAAA
CAGGCCCTTAGTACCTTCGTAACTGAGATGGATGATGAGC
CCTTCAACCCAGATTATGTGGAGGTGGACAGGGTTCTGGA
TGTGTCTGAAAGCACAGATGAAAATGGAGAGCTTGTGACT
TTGTACCTGGTAAAGTGGTGCTCCTTGCCTTATGAGGACA
GCACGTGGGAGTTAAAAGCTGACATAGACCAAGTGAAGAT
TGAGGAGTTTGAGAGAGTGATGGCGCGTGAGCCGCAGCTG
AAGCGCGTGGAGCGACCTCCCACCAGCGACTGGCAGAAAT
CCGAGAGTTCCAGAGAATATAAAAACGCCAATGCGCTCAG
GGAATACCAGCTGGAGGGAGTCAACTGGCTGCTCTTCAAC
TGGTACAACACACGAAACTGCATTTTAGCTGATGAAATGG
GACTTGGTAAAACAATCCAATCCATCACATTCCTCTATGA
GATATACCTGAAGGGAATCCACGGTCCTTTTCTTGTGATT
GCTCCTCTTTCCACTATTCCCAACTGGGAGAGGGAGTTCA
GGACATGGACGGAGCTAAACGTAGTGGTCTATCATGGTAG
CCAGGCCAGCCGAAAGACCATTCAGGCCTACGAGATGTAC
TACAGGGACACACAGGGACGTATAATAAAGGGAGCCTACA
AATTCCATGCCGTCATCACCACATTTGAGATGATCCTGAC
AGACTGCCCTGAGCTACGAAATGTGCCATGGCGCTGCGTG
ATTATTGATGAGGCTCATAGGCTCAAGAATAGGAACTGCA
AGCTGCTTGAGGGCTTAAAGATGATGGACATGGAACACAA
AGTCCTGCTGACAGGGACTCCACTGCAAAACACAGTGGAG
GAGCTTTTCAGTCTTCTCAATTTCCTGGAGCCAGATAGGT
TTCCTTCGGAGTCCACCTTCATGCAGGAGTTTGGAGATCT
TAAGACAGAAGAGCAGGTGCAAAAGCTGCAAGGAATTTTG
AAGCCTATGATGCTACGCCGACTGAAGGAGGATGTAGAGA
AAAATCTTGCACCAAAAGAGGAAACTATCATTGAAGTGGA
GCTAACCAATGTGCAGAAGAAATACTACCGTGCCATCTTG
GAGAAGAACTTTGCCTTTCTGTCCAAGAGTGGAGCAGGCG
GAGGCAGCGGAGGTGGAGGAGGATCCAATGTTCCCAACCT
GCTGAACACCATGATGGAGCTGAGAAAGTGCTGCAATCAC
CCCTACCTCATCAATGGAGCTGAAGAGAAGATAATGGAGG
AGTTCAGGGAGACTCATCCTTTAGACCAACCAGAGTTTCA
CCTCCAGGCCATGATCCAGGCTGCAGGAAAACTGGTGCTG
ATCGACAAGCTGCTCCCCAAACTGAAGGCTGGGGGTCACC
GTGTGCTCATCTTTTCCCAGATGGTGCGCTGTCTGGACAT
CCTGGAGGACTACCTCATCCAGAGACGGTATCCATATGAG
CGTATAGATGGCAGAGTTCGAGGGAATCTCCGCCAGGCAG
CTATTGACCGCTTCTCTCGACCAGACTCTGACCGCTTTGT
ATTCCTGCTGTGCACAAGGGCTGGTGGCTTGGGTATTAAC
CTAACTGCAGCTGATACATGTATTATATTTGATTCTGACT
GGAACCCTCAAAATGACCTGCAGGCACAAGCTCGATGCCA
CAGGATAGGACAGAGCAAGTCTGTGAAGATTTACCGCCTG
ATCACCAGAAACTCCTACGAAAGAGAGATGTTTGACAAGG
CCAGCTTGAAGTTAGGACTGGACAAGGCTGTGCTTCAGTC
CATGAGCGGCAGGGAGAATGCTGCCAATGGGGTTCAGCAG
CTCTCTAAAAAGGAGATTGAGGATCTCCTGCGTAAAGGAG
CATATGGAGCTCTAATGGAAGAGGAGGATGAGGGATCCAA
GTTCTGTGAAGAAGACATTGATCAGATTTTGCAGAGACGT
ACACAGACCATTACAATTGAATCAGAAGGCAAAGGCTCAA
CATTTGCTAAGGCAAGTTTTGTGTCCGCTGGGAACAGAAC
CGACATTTCTCTGGAGGACCCAGATTTCTGGCAGAAATGG
GCAAAAAAAGCAGAGCTGGACCTGGATGCGATCAATGGCA
GGAATAATCTGGTGATTGACACTCCTCGGGTCCGGAAGCA
AACTCGTCACTACAGTTCCATGAAAGAGGATGACTTGATG
GAGTATTCAGAGCTTGAGAGTGACTCTGAGGATAAACCTA
TTCAGAAACCAAGGAGGCCTCAGGACCGAACCCAGGGGTA
CCCCCGCAGTGAGTGCTTCAGAGTGGAAAAAAACCTGCTG
GTATATGGCTGGGGCCGCTGGGGTGACATCCTCTCCCATG
GACGCTTTAAGCGCCCGCTGAGGGAGCGAGACGTAGAGAC
CATCTGCCGTGCACTTCTGGCCTACTGCCTGCTCCACTAC
CGTGGAGACGAAAACATCAAGGGCTTCATTTGGGACCTCA
TAACCCCTACTGAGGATGGCCAGAGCCGCACACTGACCAA
CCATTCTGGATTGTCTGCTCCTGTTCCCCGGGGCCGTAAA
GGGAAGAAGGGGAAGTTGCCGGTTGCTCAGACACGCATGC
CACAGGCAGACTGGCTTGCTGACTGTAATCCTGACTTACT
CCTTCAGGAGGACAGTTACAAGAGACACCTGAAACACCAC
TGCAACAAAGTGCTGCTGCGGGTCCGCATGCTCTACTATC
TGCGACAAGAAGTCATCGGAGACCAGGCAGACAGAATCCT
GGAGGGAACCGATTCAAGTGAGTTGGATATCTGGATCCCA
CAACCCTTCCATGCTGACGTTCCCACTGATTGGTGGGACC
TTGACGCAGACAAGTCCCTCCTTATCGGCGTCTTCAAGCA
TGGCTACGAGAAGTATAACTCTATGCGTGCTGACCCCACC
CTGTGTTTCCTGGAGAGGGTGGGCATGCCTGATGCCAAGG
CCATCGCTGCTGAGCAGAGGGGAGCGGACATGATGGCAGA
TGGTGTCGAGGGAGAGGAAGAAGACCCAGAGTACAAACCA
CTTCGAATGTCTTTTAAAGACGATCTAGATGATTTTACAA
ACTCTCCTTTAGATGATAATAATGACGGGATGGATGGCGA
GACGGGAGAAGCACCTAAGCTTGGTGAGAACGGGAAGCCA
GGCAATCTGTACTGGCCACCAGCCTCTGCTCTGACCGCTC
GATTGCGCCGCCTCATCACAGCCTATCAGCGCACTCACAA
ACGTGAGCAACTAAGACAGGAAGCCATGGCTAAACCTGAT
CGGCGCCGGCGCCGCCCGCGTGATGACATCCTTGCTATGG
TAACAGAAGGAGGAGCTTATGTCCCTGATGGAGCAGTGGC
ATTCATGGCTGATGGAGGGGCCTTCATGGCTAAGGGATCA
CCTTTCATTCCAGACAGCGCCGCCCTGCTGGCTGATAGTG
CAGCTTATTTCAAAGAGCGACGACAGAGATGGACAAGGCG
TGAAGAGGCCGATTTCTACCGTGTGGTATCCACATTCGGT
GTAGTTTATGATGTGCACAGACAGTGCTTTGACTGGTCCC
AGTTCCGTGCCTTTGCCCGTCTAGACAAGAAGACTGACGA
GAGCTTGGAAAAATATTACTGTTCATTTGTGGCCATGTGC
AAGCGGGTGTGCCGGATGCCACTTAAATCAGAGACGGAAC
TGCCGGACCCGACCATCATCATTGACCCTATTACGGAGGA
GCGGGCTTCACGGACACTCTATCGTATTGAGCTGCTGCGG
CGGATCAGGGAGCAGGTGTTGCCGCACCCTCTTCTGGAGG
AGAGGTTAAGCCTGTGCCAGCCCAGCCCTGACCTCCCGGC
CTGGTGGGAGCCTGGACGTCATGACCGAGACCTCCTGCGT
GGAGCCGCAAAGCATGGTGTCAGCCGTACCGACTACCACA
TCCTCAACGACCCAGAGCTGAGCTTCTTGGAGGCCTATCG
GAAGTTCACACAGGGCAAAGGTGTGGAACTGCCCGTCATT
GTGTCTGATCCTCTCACTCCTCTGACCCTCCCCAAAGACG
AAGAGGTGAAGGAAGAGCAGGGAGATGTAACGCTACCCAA
AGTGGAGAATGGGAGCATAGAAGATGTTAAAGAAGAGAAA
TCTGAAGCCTTGTCTCCTAAAAAGGAAGTGAAGAATGAAG
AGGACGAAAATGGTTTGGGTCCTAAGCAAGAACCCAAAGA
GGAAAAGATGGAAGTGGAGGAGAAGGATGTGACTGAGTTT
AAGACCGATGTGGAGCAGGTTTGTCCTGTGGATGGTATGG
TTGAGAAGAAGCCAATGGATCAGGAGCCCACAGACACTCT
CCCTTCCTCTGAGGACAAGAATGCTCAGGATGAGAAAGAG
CTACCCACTGGGAATAAACTGTCTACCGAGAAAGCCTCAG
AAGATGAGGAAGAGAAAATGGATGAGGATGACAAATCAGA
AAAATCTTCACAAGCTGAAGTCGGAGCTTTATCTGAAAGG
AAGAACTTTGATGAGGAGAGCAATGCCTCCTTGAGCACAG
CCCGTGATGAGACCAATGAGACTAGAGACTGCTTTAGTGT
TGATGATGTGGAGCCATCGGCCTCTCAGATGTTCAGTGAA
CGCTCACTCTTCTCTTTCTGGCCAAAGGACAGGGTAATGA
TCAATCGAATGGACAACATCTGTGAAGCGGTCATGAAGGG
CAAGTGGCCTTCCAACAGGAGGCAGTTCTTTGACTTCCCA
GGCCTGTTGCCTGGCTACAGCTCCATGGCGACAGAAAGCC
CCCTACAGAGGCGGAGTTTGGGTGATCTCTCACTGGTGGG
TCAGACCAGCTACAGTGGAAGTGAAGACCTCACCATGTCA
CCACAGGTCAACAAGGATGATGCTTTGAGTCTGTCAGTTC
CCCGACAGCGCAGACGCAGGAGAAGGAAAATAGAGATTGA
GGCTGAGCGTGCTGCCAAGCGCAGGAACCTGATGGAAATG
GTTGCTCAGCTGCGAGAATCTCATGCAGAAGGCCAGGCTC
AGGCCATAGATCTGACCAAGGCTCTGCACAGCGTGTCCTC
CTCGTCATCCGCCTCGGCCTTCCCTGGAGCCATGGCCTCC
TCCGCAACCCTGAAAGCACAGATGGAGCTGCTACAACCGG
GTGCTTCCTCCAGACCCAGGGCCAACGGCTCACTACTTGA
CACTGAACTCCCCAACCGGAGAAAGAGAGGTCGCAGGAAA
AATGTGGAGGGGTTGGAACTGCTCTTTATGGGGAACAAGA
GAGGACAGCTCAGTGCGGAGCTTTCTGACGGGACCAAAGC
TTTTGTGGATGGACGGACACATTTAGCGATGCCGTCTCCT
GCACAGAAGGCCTCTGGTGAAGGTCTAGATGAGGGAAGTC
TTCAAGGAGAAGATGGATCCAGCACTAAGGACCTGCGGGA
ATGGCTTAGACAACACCCCACATACACCATGGATATGCCT
GGATACGTACCAAAGAATGAGGACCTCCTCCTCTCGCAGT
TTGCCAAGCCTAAACAAAAGAGGCACAGATGCCGCAATCC
CAACAAGATCGACATTAACACGCTGACCGGGGAGGAGAGG
GTCCCTGTTGTTAACATAAGGAATGGAAGAAAGATGGGTG
GAGCCATGGCCCCTCCAATGAAGGATTTACCACGCTGGCT
AGTTGAAAATCCAGAGTATGCCATAGCCCCAGACTGGACA
GATATTGTGAAGCAGTCGGGTTTTCTGCCAGAGTCTATGT
TTGACCGTCTTCTGACGGGGCCAGTGGTCAGAGAGGAGGG
TGTCCGCCGCAGGGGCAGGAGACCCAAAGCAGAGATCGCC
AAGGCCACAGCAGCAGCGCAGGCAGCAGCAGCAGCAGCGG
CAGCAGCCACCACGTCCGGTGTTAATCCTCTGCTGATGAA
CGGGCTGTTTGGAAGTATGGACCTGACCAGTTTGCAGGGT
CTGCAGAACCTCCAGAGCCTCCAGCTGGCAGCTGGCCTTA
TGGGCTTTCCTACTGCTCTTGGTGGTGGCGCAGACGCCAA
ACATGCAGCGGCCATGCTTCCCCTCATGCTTCCTGGAATG
GGTGGCCTCCCTAACATGTTCAGTCTGGGTAGTCTCTTTG
GAGGAAACCTGGCTGCAGCGGCGACAGCCACCAATGGTGC
TTCCAGCACAGAACAGGCTGAATCTGAGGAGAATTCCAAG
CCGAAGACAGACGAGGAGACCAAGGGAGAAGGAGATGAGA
AGGAAGAAAAGCAAGCCGAGAAATCGTCTGAAACTGTAGA
GTCTGCAGATGCTACTGGTGATGCTGCAGCGCTCAATGCA
GCCGCCGCCGCTGCTGCTGCTGGTATGTCTACAGGGACGC
TGGCCTTCAACCCTTTCCTGCTGTCCACTATGGCGCCAGG
TCTCTTCTACCCATCCATGTTTTTACCTCCCAGCCTCGGT
GGCCTGGCCATCCCAGGCTTCCCTCAAGCTTCTCTCGCTG
ACCTCCAGAGCGCTGTGTCCGGGGCCTTAGGAGCCACTGG
CGAGGACAAGGAGTCCGACAAAGGGCCCCGCACAAATCAG
GACCCAAATGCCTCAGTGGCTGATGTGGAAACTGCTGACA
ACACACTTGAAGACAGTGACTCAGAGGAGAGCCAGAACAA
GACTGCTGATTCATCAGTACTGGATGATGACCTGGCAGGC
CCAGCAGAGGAAATGGACTCCATGGAGGGTGGAATGGATG
ATGAGGACGACGACGACGACGATGATGATGATGACCCTGC
TGATGAGGATGACAAAAGTGACTGAATAAAAAAAAAAACT
GAATCAGGCCTTCTAACATTTCCCCAGGGCTGAGGAGACG
CTGACTGAACTCTGACAGGATGTTAGTCCAGTTGTTTACA
TGCCAACACTATCCAAAACACTTTGGTTTTTGTTGACAGG
TAACGTTAAGAGGGAAGCAAATACGCTGTCTCTGTAACCA
TTAGCATAGCCAGGGATGATGCAAACCGACGTAGAGTTGT
GCGGCTGTCAAAAGGGTGTTTTTTGTTTTATTTTATATTT
TCCATGTTTCTTTTGTTGTTGTTTTTCTTGAAGTCTTCGG
CACTGTGTGGGTGCCTTCTAGATGAGATGGAAATTTCCTG
AATATTATAGGAATTAATCGTTCCGATAGTGCTATGCTGC
TCTCTTTATTTTATTTTTTGTCCTCTCTCTCTCCCTCTCT
CTCTCTTGTTGATATTGTAACAATGAGTAGCATCTCGTAA
TATTCAGTGGTGTACAATTTAACGGCATTAAGACTCTCCG
CTGCTGAGGAAGAATCGTGGTTTTCGTTGTACTGTTCTGC
TGAGAGGAGCGAGCAAAGTTCTCACATATCATAGTCTACA
CTCGTACTGTTCCCAGTCTCTCACACTGACAATCCAAACG
GGTGAGGAGACCTCTCAACCTGTGGAGACAGCAATAACGA
AGGCAGCTTTTGAATGTTCAATTTTACTCTTCTGGACTTA
ACACCGGAAAGTGTGAAAAAGCGATATGAAATAAATTACT
GCAGTCAAATTGTCTCATTGTATCCATGTTAATGCACTGG
TGTAAGAATAAAATCAGGTACCTTTATCTATTTGAATGGA
CTTTTGTTACTTTAGCCACAAAGCTGAACAGCATTACCTC
AATTCTAACTAGCCTTGAAGTTTACAAACATAAATGTTGT
AAATTGTTTTGTTTTTTTCTTTTGTGAGTGTCTTTTTTTT
TTTTCTTCTTTTTGGTTTTTATTTTGAAACCATCATGTAT
GATGAACTGTATAAATTGCTGCCAACTGTAGTAATGATGC
TTTTAATAAAAGTGACTCACAATATTCGCCTAGGAAACCA
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations