Transcript

clcn2a-002

ID
ZDB-TSCRIPT-090929-13372
Name
clcn2a-002
Previous Names
  • si:ch211-117k11.1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031732 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031732|OTTDARG00000024260|ZDB-GENE-070705-19 clcn2a|no_translation CH211-117K11.1-002 LG_none FP236459.4,BX640595.14 Danio rerio protein_coding NOVEL, 800 bp
TCTGTACATCACGCTGTAAGAAGTTCCTGATCTCCCGTGT
GGGTGAAGACTGGATCTTCCTTATCCTCCTGGGGCTTCTC
ATGGCACTGGTCAGCTGGGCTATGGACTACACTATTGCCT
TCTGCCAGCAAGCACAGAAGTGGATGTACCGCGGTCTGCA
CAGTAACATGTTGCTGCAGTATCTGGCCTGGGTCACGTAC
CCAGTGGTCCTCATCACCTTCTCCGCCGGCTTCACACAGA
TCTTGGCGCCACAGGCAGTGGGCTCTGGGATCCCAGAGAT
GAAGACCATCCTCCGAGGTGTGGTGCTGAAAGAGTACCTC
ACTTTCAAAACCTTCGTCGCCAAAGTGATTGGCTTAACTT
GTGCCCTTGGAAGTGGCATGCCTCTGGGCAAAGAGGTGCA
TGAGATGGGGATATCTGATCCCAGATAAGCTCGCTAATGC
TGCAATACTTTAAGCCCTTGGCCTGTGATCACATCTGTTA
TTTCAATCTCCTCTTGCGTCCTCTAGGGACCGTTTGTTCA
CGTTGCCAGTCTGTGTGCTGCTCTGTTGAGCAAATTCATG
GCCTTGTTTGGAGGAATCTACATGGTGAGAAACGCCTCTA
GTAAAGCTGTCATTTTTCAGTAACTTTCTGACATTTCATA
CATTGGCAACACTTTATTATAACTTCTATTAAGAACATTA
GCATTGCCAAATATTGTTGTTGTGTTTCATAAAAACGCCG
TTATATTAAACAATTAGATATTGCTTTGTTAAGCACTCCA
AAAAATGATGTTTGCTGTTTGTTCAAACTATTTATATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations