Transcript

clcn2a-203

ID
ZDB-TSCRIPT-090929-13371
Name
clcn2a-203
Previous Names
  • clcn2a-001
  • si:ch211-117k11.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031731 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031731|OTTDARG00000024260|ZDB-GENE-070705-19 clcn2a|OTTDARP00000025792 CH211-117K11.1-001 LG_none FP236459.4,BX640595.14 Danio rerio protein_coding NOVEL, 1970 bp
ATGTATGGACGCTATACACAGGAGCTGGGGGCCTATGCCA
AAGAAGAGGCAGCTCGTCTGCGTGAGGATGGAGGGCTGCG
GAGGACCACCAGCGTTCGCGGCCAGGCTCCAGAACTGCTG
GAGTATGAGAAAGACCCATGTGCCAAGTGTCAAGTCTGTA
CATCACGCTGTAAGAAGTTCCTGATCTCCCGTGTGGGTGA
AGACTGGATCTTCCTTATCCTCCTGGGGCTTCTCATGGCA
CTGGTCAGCTGGGCTATGGACTACACTATTGCCTTCTGCC
AGCAAGCACAGAAGTGGATGTACCGCGGTCTGCACAGTAA
CATGTTGCTGCAGTATCTGGCCTGGGTCACGTACCCAGTG
GTCCTCATCACCTTCTCCGCCGGCTTCACACAGATCTTGG
CGCCACAGGCAGTGGGCTCTGGGATCCCAGAGATGAAGAC
CATCCTCCGAGGTGTGGTGCTGAAAGAGTACCTCACTTTC
AAAACCTTCGTCGCCAAAGTGATTGGCTTAACTTGTGCCC
TTGGAAGTGGCATGCCTCTGGGCAAAGAGGGACCGTTTGT
TCACGTTGCCAGTCTGTGTGCTGCTCTGTTGAGCAAATTC
ATGGCCTTGTTTGGAGGAATCTACATGAACGAGCTGAGAA
ACACAGAGATGCTGTCAGCTGCCTGTGCAGTGGGGGTGGG
CTGTTGCTTTGCGGCCCCCATTGGAGGAGTGCTGTTTAGT
ATTGAGGTCACATCAACGTTCTTCGCCGTGAGGAACTACT
GGAGAGGATTCTTCGCTGCAACCTTCAGTGCCTTTATCTT
CAGGGTGCTGGCGGTGTGGAATAAGGATGAGGAGACCATC
ACGGCCCTCTTTAAAACACGCTTTCGACTGGATTTTCCTT
TTGACCTACAAGAGCTTCCTGCTTTCGCTGTGCTCGGGAT
TGCCAGTGGTTTTGGAGGAGCATTGTATGTCTATCTGAAC
AGGATTATAGTGGAGTCTATGAGAAAGCAGAAAACTATCA
ACAAATTTTTGCTAAAAAAAAGACTAGTGTATCCAGCAGT
GGTGACTCTTCTTATATCAACACTTACCTTTCCTCCAGGG
TTTGGACAGTTCATGGCAGGCCAGCTGACTCAACATGAGT
CACTGGTGGCACTGTTTGACAACCTGACCTGGTACAAGCA
AGGTGTTGCTGAGGAGTTTGAGTACTCAAGTCACGTACCT
CAGGCCTGGAAGCACCCACAAGTCAGTGTGTTTATCACAC
TCCTCCTCTTCATTGTCATGAAGTTCTGGATGTCAGCCGT
GGCTACAACAATGCCTGTGCCTTGCGGGGCCTTCATGCCG
GTGTTCCTCATTGGGGCCGCATTCGGTCGACTGGTGGGCG
AAAGTATGGCAGCCTTCTTCCCCGACGGGATACACGCCGA
CAGCACTGTGTATCCTATAGTTCCCGGCGGTTACGCAGTT
GTAGGGGCGGCGGCTCTTTCTGGCGCAGTCACTCACACCG
TGTCCACCGCCGTCATCGTGTTCGAGCTGACCGGTCAAAT
CTCGCACATCCTGCCCGTGATGATCGCTGTGATCCTGGCC
AATGCCGTGGCTCAGAGTCTACAGCCGTCCCTCTACGACT
CCATCATCCGGATCCAGAAACTTCCCTATCTGCCAGAGCT
GGGCTGGGGACAGGAGAAATATAATATCCGCGTGGAGGAT
ATAATGGTGAGAGATGTGCGCTATATCACTCTCTCCTCCT
CTTACCGGGACCTCCAGGAGGCACTTGTGACGGGCCAGCT
TAAAACCCTGGCCCTCGTCGAGTCCAAAGAGTCCATGATC
CTGCTGGGTTCGATCGAGCGCTCTCAGCTTCAGTCGCTGC
TCTCTCAGCAGCTCGGCCGGCCCCGCAGGCTGGAGTATCT
GAGAGAGCGAGCACAGGACAACGGCACCCATGTGCCCACC
TTCACACCGGATTCACCTCCCAAGGCTGGCCGCGGCGTAC
GTTTCCTGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations