ZFIN ID: ZDB-TSCRIPT-090929-13088
Transcript Name: cxxc1b-002
Previous Name: cxxc1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031062 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031062|OTTDARG00000023783|ZDB-GENE-030728-4 cxxc1b|no_translation cxxc1-002 LG_ CT573282.6 Danio rerio protein_coding KNOWN, 497 bp
CCAGTGTGCTTGAATATTATTCCATAGTCACATAAAGTAA
TTATTTTAATCAGCACTGTAGAGCTCTAAGGGTGTCTCAC
AATATCACATTTGCAATCACTTGACTTCATACTGTGTCAA
TCTGTGCAGTCGCATCTATGAAATCCTCCCGCAGCGCATC
CAACAGTGGCAGCAAAGCCCTTGCATTGCGGAGGAGCAGG
GTAAAAAACAGCTGGAGCGCATCCGCCGAGAGCAGCAGGC
CGCACGTATGCGCCTGGCAGAGATGGAGCGCCGTTTCCAC
GAGCTGGAGGGCATCATTGCCAAAGCCAAGCAGCAGCTGG
TCCTTCAGGATGAGGACGTGAATGAAACAGACAGTGAGGA
CACAGACCTTCAGATCTTCTGTGTGTCCTGTAGTCACCCC
GTCAACCCCAAGGTGGCACTCAGGCATATGGAGAGATGTT
ATGCCAAGTATGAAAGCCAGACGTCTTTCGGTTCCATTTT
CCCAACTAGAATAGAAG

cxxc1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cxxc1b-201 (1)    Ensembl 2020
ncRNA cxxc1b-002 497
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cxxc1b-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031062 (1),  Ensembl_Trans:ENSDART00000147815 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AI558515 (1) 520 nt
CITATIONS (2)