header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13087
Transcript Name: cxxc1b-201
Previous Names: cxxc1-001, cxxc1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031061 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031061|OTTDARG00000023783|ZDB-GENE-030728-4 cxxc1b|OTTDARP00000025273 cxxc1-001 LG_ CT573282.6 Danio rerio protein_coding KNOWN, 2020 bp
ATTAGCCTTCTGCGCACATACACAGCCGAAACGACGTTGT
TAGCTGTCTGCCCACGGTCAGAATATTTCTGTTTATAATA
CCGCTTCATTTCTATTTTTATGTGGGCATTTATTTCAGTT
ATTATAGTCGCAGCATTCACTATGCAGTGATATATTATAT
GAATTAATTGATAGTTCATCCGTTTGATCGGATCCTTTTG
AAGGCGGGGAGCAGCGATGGACAGCGAAATGTCTGATATG
GACCAGACTCCAGGTCTGGACAACAGTATGGAAAAAGGAG
AAAATGCTCCTCTTTACTGCATTTGTCGAAAATCAGACAT
CAACTGCTTCATGATTGGTTGTGACAACTGCAATGAGTGG
TTTCACGGTCACTGTATTAATGTGACGGAGAAGATGGCCA
AAGCTATAAGAGAGTGGTACTGTCAACAGTGTCGGGCAAG
GGATCCATCACTTTCAATACGATATCGAAAGAAGAACCGC
GATAAAGATGTTGAGCCCGAGAGGGTTGAGAAACGATCCA
GCACTCCAGAATACAAGATTGATAAGCGACGTGGGTCTAA
AGTGAAGCGCTCTGCCCGTATGTGTGGTGAATGTGAACCC
TGCACCAGGACAGAGGACTGTGGTCATTGCGACTTCTGTA
AAGACATGAAGAAATTTGGAGGCCCAAACAAGATTCGTCA
GAAGTGTCGTCTGAGGCAGTGTGTTGTTCGTGCTCGGAAA
ATGCTGCGTGTTCGGGATGAGGAGTTTTCGCTGCGTGAGA
GGAAAGACAATATAATGCACAGGAATAGACGATACTCAGA
TGATTATGATGAGAACGATATGGATCTATATGAGCACTAC
AAGGACAGAAATGCGTCATGGGGCAGTGAGGATGATGATG
GCCAACTATACAGTCCTGTTCCACGGAAGAAAGCTATAAA
AGTCAAGCACGTCAAGAGGAGAGACAAAAAATTTGACAAG
AAGAAAGAGTCCCGTCGCCACAAGCAGAAGCAGAAGCACC
GTGATCGTTTGCGACACAGTGATAGGACAGACGGCAGACA
CGGAGGAGACACGCAACAGTGCCTGGGGCCAAACTGCATT
GAGCCGGCACGGCCAAACTCAAAATACTGCTCTGAGGACT
GTGGCATGAAGCTGGCCGCCAATCGCATCTATGAAATCCT
CCCGCAGCGCATCCAACAGTGGCAGCAAAGCCCTTGCATT
GCGGAGGAGCAGGGTAAAAAACAGCTGGAGCGCATCCGCC
GAGAGCAGCAGGCCGCACGTATGCGCCTGGCAGAGATGGA
GCGCCGTTTCCACGAGCTGGAGGGCATCATTGCCAAAGCC
AAGCAGCAGCTGGTCCTTCAGGATGAGGACGTGAATGAAA
CAGACAGTGAGGACACAGACCTTCAGATCTTCTGTGTGTC
CTGTAGTCACCCCGTCAACCCCAAGGTGGCACTCAGGCAT
ATGGAGAGATGTTATGCCAAGTATGAAAGCCAGACGTCTT
TCGGTTCCATTTTCCCAACTAGAATAGAAGGGGCAACAAG
ACTTTTCTGTGACGTGTACAACCCTCAGAGTAAAACATAC
TGCAAGAGACTGCAAGTTTTATGTCCAGAACATTCCAGAG
ACCCAAAGGTCACATCAGATGAGGTGTGTGGATGTCCACT
AGTCCGTAACGTGTTTGATCCAACTGGAGATTACTGCAGG
GTCTCCAAACGCAAGTGCAACAAGCACTACTGCTGGGAGA
AGCTCAGGCGGGCCGAGGTGGACCTGGAGCGTGTCAGAGT
GTGGTATAAACTGGACGAGTTGTTTGAACAGGAACGCAAT
GTGAGGACGGCCATGACCAACAGAGCGGGACTGCTGGCCC
TCATGCTCCACCAGACCATCCAGCATGACCCGCTGACCAC
CGACCTCCGCAGCAGCAAAGACAGATAGCCATCTCAGTAA
TCAGTATTCACTTGAAAAAACCCTCCTGTTCATATTTGTA
TATTTTTCATATTGTATATTTTGTCACTTTGACCATTCAC
ATTAAACACCTTCATGTGTC

cxxc1b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cxxc1b-002 (1) 497
mRNA cxxc1b-201 2020
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cxxc1b-201 Contained in:
OTHER cxxc1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000031061 (1)
  • Ensembl_Trans:ENSDART00000035602 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC052918 (1) 2005bp
    GenBank:DT882656 (1) 867bp
    GenBank:BI892063 (1) 717bp
    GenBank:DY557807 (1) 668bp
    GenBank:AW422303 (1) 662bp
    GenBank:BM860805 (1) 601bp
    GenBank:BG728163 (1) 586bp
    GenBank:BM182766 (1) 574bp
    GenBank:AL914458 (1) 537bp
    GenBank:BG728340 (1) 534bp
    GenBank:AL725575 (1) 458bp
    GenBank:BM403619 (1) 448bp
    GenBank:AL914459 (1) 420bp
    GenBank:BM141204 (1) 392bp
    CITATIONS (2)