header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12873
Transcript Name: nasp-209
Previous Name: nasp-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030764 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030764|OTTDARG00000023589|ZDB-GENE-030131-5511 nasp|OTTDARP00000025046 nasp-003 LG_ CR854855.7 Danio rerio protein_coding NOVEL, 734 bp
TGCAGAAGTTGGAGTTGAATCAGGAAACTACAGTCAGGCT
CTGGAGGACTTCAATGAGTGTTTAACCCTGCAGCTCAAGC
ACCTTCCCTCTCATAGTCGTCTTTTGGCTGAGACTCATTA
TCAGTTGGGCACCACTTACAGTTACACCACACAATACAAC
CAAGCCATAGAGCACTTCTCCAACTCTATCAAAGTCATCG
AGAGCCGTCTTGCTATGCTTCAGGAGGTGATCGACAAGGC
AGAAGGTGAAGACTCAGCAAAGGAAGAGAAGGGCGAGTTT
GAGGAGTTGAAACAGTTGCTGCCAGAAATTAAAGAGAAGA
TTGAAGATGCCAAGGAGAGCCAGAGGACAGCTGCAGCAGC
TTCAGAGGCCATCCATCAGACTCTAGCTGGAGCATCCACA
TCATCTGCATTCCCCACTGAAAATGGTGGCCCGTCTTCAT
CCACTGCTAGTCAGATTGCTGTGAGGCCAGCTGATGGCGC
CTCTTCCTCCAAATCTGCATCTGATATTTCTCACCTTGTC
CGCAAAAAGCCAGCCAACTCTTCCTCTGTGGAGACCTCCG
CGTGATGGGCATCTTCTGATTGACTCCTTACCTTCCAACC
AGCAGAGCATGCCTGCCTCATCTACTCCCCATGAACAACT
TTTTGTCTCTGTTTTGTAAATAACCAGATTTCTTTGTCTG
TTCGATTTTTGTATACTTGTAGTAAACTTTCAATAAAGGA
TATTTGCATATGTG

nasp TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA nasp-005 (1) 868
nasp-006 (1) 643
nasp-007 (1) 527
nasp-008 (1) 658
nasp-009 (1) 620
nasp-010 (1) 966
nasp-011 (1) 698
aberrant processed transcript nasp-202 (1) 1899
mRNA nasp-204 (1) 1143
nasp-205 (1) 2185
nasp-209 734
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nasp-209 Contained in:

OTHER nasp-209 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030764 (1)
  • Ensembl_Trans:ENSDART00000146373 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI721448 (1) 692 bp
    GenBank:BM957926 (1) 677 bp
    GenBank:BI843365 (1) 620 bp
    GenBank:BI709436 (1) 617 bp
    GenBank:BM889572 (1) 531 bp
    CITATIONS (2)