ZFIN ID: ZDB-TSCRIPT-120213-750
Transcript Name: nasp-009
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054722 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054722|OTTDARG00000023589|ZDB-GENE-030131-5511 nasp|no_translation nasp-009 LG_ CR854855.7 Danio rerio protein_coding NOVEL, 620 bp
GAGCAGCTTCACAAACCCGCCACAGACACACGCATCATCC
AACAGTACAGTTCAGCTTAGTTTATTTAACGCATTAAAAT
GCCCGAAGAAACAGGAGCTACTTCAACCGCGGAAAGGATG
GAAGAGAAACCTTGCTCCTCAAGCACTGGAGACAGTTCTG
TCGATGTCGCTGAGGAAGCAAAGAAGCTGATTGGCACTGG
AAGTCGGCACTTAGTGATGGGTGATGTTGTGTCTGCAGTC
AGTGTGTTCCAGGAGGCTTGTGCCATGCTAGCTGAGAAGT
ATGGAGACACTGCTGATGAATGTGGGGAAGCTTTTTTCTT
TTGTGGGAAGGCCCTTCTGGAGCTTGCCAGGATGGAGAAC
ACTGTGCTCGGTAATGCTTTAGAAGGAGTCCCAGAAGAAT
CCTCTGAGGAGGGTGAGAAGCAGGATGACTCGAAGATCGA
AAGTGCTGACAACTTGGATGAGAAAACCAGGGATGAACTT
CGAGCACAGGTTTATGATGCCATGTCAGAGGACAATACTC
GGTCAGAGGTAGAAAAAGAGGAATGTGGTGAAGGCGAACG
GAACAACAAAGAGGAAGATGAGAAGCAGGTAAAGTTGGGC
ACCACTTACAGTTACACCAC

nasp TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA nasp-005 (1) 868
nasp-006 (1) 643
nasp-007 (1) 527
nasp-008 (1) 658
nasp-009 620
nasp-010 (1) 966
nasp-011 (1) 698
aberrant processed transcript nasp-202 (1) 1899
mRNA nasp-204 (1) 1143
nasp-205 (1) 2185
nasp-209 (1) 734
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nasp-009 Contained in:
OTHER nasp-009 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054722 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BU710252 (1) 619bp
    CITATIONS (1)