header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12872
Transcript Name: nasp-204
Previous Name: nasp-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030763 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030763|OTTDARG00000023589|ZDB-GENE-030131-5511 nasp|OTTDARP00000025045 nasp-002 LG_ CR854855.7 Danio rerio protein_coding NOVEL, 1143 bp
GTCCGTATTTAAAGGCGCCAACAAAGACTAATTCAGGAGC
AGCTTCACAAACCCGCCACAGACACACGCATCATCCAACA
GTACAGTTCAGCTTAGTTTATTTAACGCATTAAAATGCCC
GAAGAAACAGGAGCTACTTCAACCGCGGAAAGGATGGAAG
AGAAACCTTGCTCCTCAAGCACTGGAGACAGTTCTGTCGA
TGTCGCTGAGGAAGCAAAGAAGCTGATTGGCACTGGAAGT
CGGCACTTAGTGATGGGTGATGTTGTGTCTGCAGTCAGTG
TGTTCCAGGAGGCTTGTGCCATGCTAGCTGAGAAGTATGG
AGACACTGCTGATGAATGTGGGGAAGCTTTTTTCTTTTGT
GGGAAGGCCCTTCTGGAGCTTGCCAGGATGGAGAACACTG
TGCTCGGTAATGCTTTAGAAGGAGTCCCAGAAGAATCCTC
TGAGGAGGGTGAGAAGCAGGATGACTCGAAGATCGAAAGT
GCTGACAACTTGGATGGTGATGACGATGGTGATGAGGATG
AGGACGATGATGAGGATGCAGAGGGTGATGCTAAGGATAA
GGAGAGTGAGGAGGATGAAGTTGGAAACCTGCAGTTGGCC
TGGGAGATGCTTGAAGTTGCTAAAGTTATTTATAAAAGAA
AAGATGACAAAGAAGATCAGTTAATGGCAGCACAGATTCA
CCTGAAACTTGCAGAAGTTGGAGTTGAATCAGGAAACTAC
AGTCAGGCTCTGGAGGACTTCAATGAGTGTTTAACCCTGC
AGCTCAAGCACCTTCCCTCTCATAGTCGTCTTTTGGCTGA
GACTCATTATCAGTTGGGCACCACTTACAGTTACACCACA
CAATACAACCAAGCCATAGAGCACTTCTCCAACTCTATCA
AAGTCATCGAGAGCCGTCTTGCTATGCTTCAGGAGGTGAT
CGACAAGGCAGAAGGTGAAGACTCAGCAAAGGAAGAGAAG
GGCGAGTTTGAGGAGTTGAAACAGTTGCTGCCAGAAATTA
AAGAGAAGATTGAAGATGCCAAGGAGAGCCAGAGGACAGC
TGCAGCAGCTTCAGAGGCCATCCATCAGACTCTAGCTGGA
GCATCCACATCATCTGCATTCCCCACTGAAAATGGTGGCC
CGTCTTCATCCACTGCTAGTCAG

nasp TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA nasp-005 (1) 868
nasp-006 (1) 643
nasp-007 (1) 527
nasp-008 (1) 658
nasp-009 (1) 620
nasp-010 (1) 966
nasp-011 (1) 698
aberrant processed transcript nasp-202 (1) 1899
mRNA nasp-204 1143
nasp-205 (1) 2185
nasp-209 (1) 734
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nasp-204 Contained in:

OTHER nasp-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030763 (1)
  • Ensembl_Trans:ENSDART00000137447 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH457062 (1) 1034 bp
    GenBank:CT588358 (1) 784 bp
    GenBank:CK680706 (1) 545 bp
    GenBank:CK711392 (1) 539 bp
    CITATIONS (2)