ZFIN ID: ZDB-TSCRIPT-090929-12423
Transcript Name: mfsd5-203
Previous Name: mfsd5-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030165 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030165|OTTDARG00000021944|ZDB-GENE-040718-468 mfsd5|OTTDARP00000024575 DKEY-18F23.5-003 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 736 bp
CCGGAAACACACGCGGATGTTGTAGAACATATATTGCAGG
CATTTAGATGAAAAAAGCGTCTGAATTCATGGCGTAGAAA
AGGTATTTAATAATCCCAAATCAGCGGACAGTTTCTAAAT
TCCTTAGAAAAATGTTAAGAGTACGAAGTCAAGCTGACAG
TTGCTCATGATGAGTCCAGAAATGAACCATTAATTTCAAT
GCCCCAAAAGCTGTAGGAGGATGTTGATCTAGGATTTCTT
CTGATTCCTCCACTCACCTTCAGACAGATTTGTGCCCATC
ATGTTTGTGACGGCATACCTAGCATTTATAGTCCTAGCAG
GACTGTGTGTGGCTTTAGAGATCACAGCCCGGCGTCTCAC
CTTATCCCAGGCCACACAGACAGCAGTCGCCAATCCGGCT
TTCCAGCGTTTCCAGAAGCTCTTTCTGAAGGCGTATCTCC
TGGCTCTCTGGGCAGACTGGCTACAAGGGCCTTACCTTTA
CAAACTATACCGACATTACAACTTCTTGGAGTCACAGATT
GCCATCCTATACGTCTGCGGTCTGGCTTCTTGTGTGCTGT
TTGCCCCGGTGGCCGGATGGCTGCCACAGTTTCTCGGCCG
AAGACAGACGTGCCTCCTCTTCTGCTTGGCTTATTCAGTG
TGTTGCATCACCAAACTCTCACAAGACTATTTTATGCTCA
TTCTAGGACGTGTATTAGGCGGCCTGTCCACTTCTCTGCT
AACAACCACCTTTGAG

mfsd5 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mfsd5-201 (1) 2975
mfsd5-202 (1) 837
mfsd5-203 736
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mfsd5-203 Contained in:
OTHER mfsd5-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030165 (1)
  • Ensembl_Trans:ENSDART00000142369 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DV595684 (1) 756bp
    CITATIONS (2)