ZFIN ID: ZDB-TSCRIPT-090929-10643
Transcript Name: mfsd5-201
Previous Name: mfsd5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028114 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028114|OTTDARG00000021944|ZDB-GENE-040718-468 mfsd5|OTTDARP00000023002 DKEY-18F23.5-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 2975 bp
TTTTGCGTCATGACGCCTGAGTAACCCGGAAACACACGCG
GATGTTGTAGAACATATATTGCAGGCATTTAGATGAAAAA
AGCGTCTGAATTCATGGCGTAGAAAAGAAGTCAAGCTGAC
AGTTGCTCATGATGAGTCCAGAAGTGAGTTTATCCAACAG
TCATGTGTCACGTGATGATATGAACCATTAATTTCAATGC
CCCAAAAGCTGTAGGAGGATGTTGATCTAGGATTTCTTCT
GATTCCTCCACTCACCTTCAGACAGATTTGTGCCCATCAT
GTTTGTGACGGCATACCTAGCATTTATAGTCCTAGCAGGA
CTGTGTGTGGCTTTAGAGATCACAGCCCGGCGTCTCACCT
TATCCCAGGCCACACAGACAGCAGTCGCCAATCCGGCTTT
CCAGCGTTTCCAGAAGCTCTTTCTGAAGGCGTATCTCCTG
GCTCTCTGGGCAGACTGGCTACAAGGGCCTTACCTTTACA
AACTATACCGACATTACAACTTCTTGGAGTCACAGATTGC
CATCCTATACGTCTGCGGTCTGGCTTCTTGTGTGCTGTTT
GCCCCGGTGGCCGGATGGCTGCCACAGTTTCTCGGCCGAA
GACAGACGTGCCTCCTCTTCTGCTTGGCTTATTCAGTGTG
TTGCATCACCAAACTCTCACAAGACTATTTTATGCTCATT
CTAGGACGTGTATTAGGCGGCCTGTCCACTTCTCTGCTAA
CAACCACCTTTGAGGCCTGGTATGTGCACGGTCACGTTGA
CATCCATGACTTCCCCAAAGAATGGATCCCTGTTACGTTT
GGTAAAGTCGCCAATTGGAATTATGGACTTGCAGTTGGTG
CTGGACTAGTGGCGAATTTGTTCGCAGAATGGCTTGGGTT
GGGACCGGTCGCTCCATTTCTGTTGGCTATCCCGAGCCTT
GCTGCTTGCGCCTGGTTTGTGCTTTCCGAATGGGGTCAGG
AGGACAAACAAGAAGGCATGAATGGAGACAAAAACGCCCC
CCTTCTTAACTCCCTAAACACCCCCAAGTTGCAATTGTCA
GCACGTGCCCGTTTCTGGCGTAGCTGTGTGGATGGCCTTC
GATGCCTGCTCTCGGACCGCCGTGTTATGCTTTTAGGAGG
CGTTCAGGCACTTTTTGAAAGCGTGCTGTATATTTTTGTA
TTCCTGTGGACTCCTGTTTTGGATCCTCATGGCCCACCTT
TAGGAATCGTATTCTCCAGTTTGATGGCGGCCACCATGGC
GGGCTCCACACTTTTCCGATTGGCCACATCAGCCCCGTAT
CGACTCCAACCCGGTCATCTGCTCTGCCTAGCCATTCTTC
TAGCGTTCTTCTCCTTCTTCATGCTGACGTTCTCCACCGT
GCCTGGCCAGCCCCGGCCCAGGGAATCTCTGCTCGCTTTC
CTTCTGCTGGAGCTGGCTTGTGGGCTTTATTTCCCAGCGG
TGAGTTTCCTCCAGGGTCGTGTGGTTCCCGTGGAGCGCAG
AGCTGCAGTTTTGGCTTGGTTTCGTTTGCCTCTGCACCTC
CTGGCCTGTCTGGGGCTGCTGGCGCTTCACGGGGAGGTTT
CAGGGTCCGGTGCGGGAGAGGCTGGCAGCGGCACCAGGCA
CATGTTTGCAGGCTGTGCTGGGATGATGCTGGCCGCTCTG
CTCGCCGTTATCAGCCTTTTCACTGTGGGCAGGAATGATG
CCGACCTGAGATTAGAGGGCCCCAAACTGGAAGGAGAAAT
CTGAGTTGGACAGTGGATTATATATGGACTGTTGAAGTGA
ATCTATTCAATAGGATAGATCAGTGTTTCCCAACCCTGTT
CCTGAAGGCACACCAAGACATTTTCAACCTCTTCCTATTC
AAACACACCTGAATCAACTCATCAGAACATTAGAAGAAAA
CCTGAAATGAATGGGTCAGATAAGGCAGACAGCCAAAATA
TGAACTGTTGGGTTGCTTCCAGGAACAGGGTTGGGAAACA
CTGGGATAGACCTTTGAGATGAAACATCTCATTTTCAACG
GCGTCCCTATGAAGTACATAAAAGAAAAAAGAAAAAAAAA
GAGTACAATACATCAAAACAAACAGAGATTGTGGACTGTG
GTTTTATATACTTTGTTTCTTTCCTCATGCATTCTGTCTT
GGTTAAACAATTGTATTTATGGGTAAATGCGAATGTTAAT
AGAACCAATAAACTCAAAATCGGATGTATTTCTAAAATGT
GTTTAGGAATTAAATTGGGGCGCGATATGTTCAACAAGTC
AGTGAGCCGGTGAGGGATCACAAACACACATTGTGAAATG
CGTAGGGTTTTTTTTTTATCCATACGGCGTGCGGTATAAA
ATTCCATTAAAACTACACTCTTCTAGCAGTTCATACTCTC
ATCCAATATCTTGTTTTGACTTGGGGGGGGCATGCATGAA
ATGCTCCTGAATGAAAGTAAAAAAGTGGCAAACTGCAGTT
AAAGTCGACAAATTAAAAATAAAACACTTGAGATTACATG
AAACTCCAGAGGAAATGTTGGATAGTGTGGTGAAGCAATG
ACATAAATCAAACTGTGCTATAACATGTAAAACAGAATCA
TGAAAGGAACATTCAAAACACAACTAATGTAAACACCTTA
ATCATTGTATTATCCTATTTAGATTAAGACAAATATTTTG
ATTACTGATGCAAACATTTATTTTAACACCAAGCCGATAC
CCTGGAGTAGATTCCCTATACAGTATGTATTGAACTGTGG
CTACTGTTTGAGCTACAATTAAAGCACAGTGTGATTATTA
AAACAATAGGCTATGCATTAGTAATAAATGCAATAAGACA
GTTTTTACATCCATCTCATGCTGCACACAGACCATACGGA
CAGGTTAAGGTAAGCATTTTCATTTATTGAAATAGATGGC
AACTGAACAAATTAAGGCTCATGAACAAACATCTTAGAAA
GCACTGTAAATAAATGCATATTTGAAAAATATAAAAATAA
AAATTACAAAATAAA

mfsd5 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mfsd5-201 2975
mfsd5-202 (1) 837
mfsd5-203 (1) 736
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mfsd5-201 Contained in:
OTHER mfsd5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028114 (1)
  • Ensembl_Trans:ENSDART00000011004 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076536 (1) 2945bp
    GenBank:AW174083 (1) 569bp
    CITATIONS (2)