ZFIN ID: ZDB-TSCRIPT-090929-12422
Transcript Name: mfsd5-202
Previous Name: mfsd5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030164 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030164|OTTDARG00000021944|ZDB-GENE-040718-468 mfsd5|OTTDARP00000024574 DKEY-18F23.5-002 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 837 bp
GCGTCATGACGCCTGAGTAACCCGGAAACACACGCGGATG
TTGTAGAACATATATTGCAGGCATTTAGATGAAAAAAGCG
TCTGAATTCATGGCGTAGAAAAGAAGTCAAGCTGACAGTT
GCTCATGATGAGTCCAGAAATGAACCATTAATTTCAATGC
CCCAAAAGCTGTAGGAGGATGTTGATCTAGGATTTCTTCT
GATTCCTCCACTCACCTTCAGACAGATTTGTGCCCATCAT
GTTTGTGACGGCATACCTAGCATTTATAGTCCTAGCAGGA
CTGTGTGTGGCTTTAGAGATCACAGCCCGGCGTCTCACCT
TATCCCAGGCCACACAGACAGCAGTCGCCAATCCGGCTTT
CCAGCGTTTCCAGAAGCTCTTTCTGAAGGCGTATCTCCTG
GCTCTCTGGGCAGACTGGCTACAAGGGCCTTACCTTTACA
AACTATACCGACATTACAACTTCTTGGAGTCACAGATTGC
CATCCTATACGTCTGCGGTCTGGCTTCTTGTGTGCTGTTT
GCCCCGGTGGCCGGATGGCTGCCACAGTTTCTCGGCCGAA
GACAGACGTGCCTCCTCTTCTGCTTGGCTTATTCAGTGTG
TTGCATCACCAAACTCTCACAAGACTATTTTATGCTCATT
CTAGGACGTGTATTAGGCGGCCTGTCCACTTCTCTGCTAA
CAACCACCTTTGAGGCCTGGTATGTGCACGGTCACGTTGA
CATCCATGACTTCCCCAAAGAATGGATCCCTGTTACGTTT
GGTAAAGTCGCCAATTGGAATTATGGACTTGCAGTTGGTG
CTGGACTAGTGGCGAATTTGTTCGCAGAATGGCTTGG

mfsd5 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mfsd5-201 (1) 2975
mfsd5-202 837
mfsd5-203 (1) 736
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mfsd5-202 Contained in:
OTHER mfsd5-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030164 (1)
  • Ensembl_Trans:ENSDART00000141141 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK140568 (1) 802bp
    GenBank:BI887093 (1) 577bp
    GenBank:EB910114 (1) 147bp
    CITATIONS (2)