ZFIN ID: ZDB-TSCRIPT-090929-12023
Transcript Name: erlin1-202
Previous Names: erlin1-002, zgc:110547-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029640 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029640|OTTDARG00000022862|ZDB-GENE-050327-13 erlin1|OTTDARP00000024190 CH211-223P8.2-002 LG_ AL929005.7 Danio rerio protein_coding KNOWN, 967 bp
ACAAAGCGTTTCAGTGGGAACCTTCCAACCTACAATGTTG
GGCACAGCGTCGTGAGTAAAAAGTAATGTCTTGCAAAAGT
GAAGGGACGGCGTTGTCCGTCAACTGAACGAATGGTCTGT
AAATGCTTCCTGCGGCTGCTGCTAGCTCCTCGTATATGTC
GTTTAACTTGACAGAAGCTCGTTTTGCCACAAGGTGAGTG
CAGACTGAGGGATAATGGCACATGTTGGGGCAGTTGTTGC
TGCTATGGCCGGTCTAATGGCCATTCTGCTTCATTCTTCC
ATACACAAGATCGAGGAAGGACATTTAGCTGTGTATTACA
GAGGAGGAGCTTTGTTGACCTCTCCAAATGGCCCAGGTTA
CCATATAATGCTGCCTTTCATCACTTCTTATAGATCAGTG
CAGACAACTCTGCAAACAGATGAAATAAAAAATGTGCCTT
GTGGAACTAGTGGGGGTGTAATGATCTATTTTGACAGAAT
TGAAGTGGTCAACATGCTCATTCCAACCTCAGTGGTGGAT
ATAGTGAGGAATTACACTGCAGATTATGACAAGACGCTAA
TCTTCAATAAAATTCACCATGAGTTAAACCAGTTCTGCAG
TGTGCACACACTACAGGAAGTCTACATTGAGCTGTTCGAC
ATAATTGATGAGAACTTGAAGACTGCACTACAGAAGGACT
TGAATTGTATGGCCCCTGGTCTCACCATTCAGGCCGTGAG
AGTCACCAAACCTAAAATTCCAGAGGCAATCAGAAGAAAT
TATGAGCTCATGGAAGCAGAGAAGACCAGGCTGCTCATCA
CCGTTCAGACACAAAAAGTGGTGGAAAAGGAGGCAGAAAC
TGAAAGAAAGAAGGCCATCATAGAGGCTCAGAAAGTGGCT
CAGGTGGCAGAGATTCAGTTCCAACAAAAAGTGATGGAGA
AGGAAACTGAGAAAAAGATCTCAGAAATTGAAGATGCTGC
TTTCCTG

erlin1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA erlin1-201 (1)    Ensembl 3706
erlin1-202 967
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
erlin1-202 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000029640 (1),  Ensembl_Trans:ENSDART00000137934 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH591622 (1) 990 nt
GenBank:EH457222 (1) 849 nt
GenBank:EB962559 (1) 349 nt
CITATIONS (2)