ZFIN ID: ZDB-TSCRIPT-090929-12022
Transcript Name: erlin1-201
Previous Names: erlin1-001, zgc:110547-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029639 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029639|OTTDARG00000022862|ZDB-GENE-050327-13 erlin1|OTTDARP00000024189 CH211-223P8.2-001 LG_ AL929005.7 Danio rerio protein_coding KNOWN, 3706 bp
GAAAGGGAATCTGTATCGGATTCACAAAGCGTTTCAGTGG
GAACCTTCCAACCTACAATGTTGGGCACAGCGTCGTGAGT
AAAAAGTGAGTGCAGACTGAGGGATAATGGCACATGTTGG
GGCAGTTGTTGCTGCTATGGCCGGTCTAATGGCCATTCTG
CTTCATTCTTCCATACACAAGATCGAGGAAGGACATTTAG
CTGTGTATTACAGAGGAGGAGCTTTGTTGACCTCTCCAAA
TGGCCCAGGTTACCATATAATGCTGCCTTTCATCACTTCT
TATAGATCAGTGCAGACAACTCTGCAAACAGATGAAATAA
AAAATGTGCCTTGTGGAACTAGTGGGGGTGTAATGATCTA
TTTTGACAGAATTGAAGTGGTCAACATGCTCATTCCAACC
TCAGTGGTGGATATAGTGAGGAATTACACTGCAGATTATG
ACAAGACGCTAATCTTCAATAAAATTCACCATGAGTTAAA
CCAGTTCTGCAGTGTGCACACACTACAGGAAGTCTACATT
GAGCTGTTCGACATAATTGATGAGAACTTGAAGACTGCAC
TACAGAAGGACTTGAATTGTATGGCCCCTGGTCTCACCAT
TCAGGCCGTGAGAGTCACCAAACCTAAAATTCCAGAGGCA
ATCAGAAGAAATTATGAGCTCATGGAAGCAGAGAAGACCA
GGCTGCTCATCACCGTTCAGACACAAAAAGTGGTGGAAAA
GGAGGCAGAAACTGAAAGAAAGAAGGCCATCATAGAGGCT
CAGAAAGTGGCTCAGGTGGCAGAGATTCAGTTCCAACAAA
AAGTGATGGAGAAGGAAACTGAGAAAAAGATCTCAGAAAT
TGAAGATGCTGCTTTCCTGGCGAGAGAGAAGGCACGAGCA
GATGCTGAATATTACACCGCTGCAAAATTTGCTGAAGCCA
ACACGCTCAAGCTCACGCCAGAGTATCTGCAGCTGATGAA
GTACCAGGCCATAGCTGCCAACAGCAAGATCTACTTCGGT
CAGGACATCCCAAACATGTTTGTAGACAGCAGTGCCTCCC
GTCCGGCCGCAGGAGAATCCGAGCAGCTGGAGTCCTTGAG
CATGAGAGAGAGTCTTAAGAAAGCGTCCAAGCCCAAAGCC
TCAGAAGGCCACTGAAGGGCCTGAGATCTGTCCACCCCCT
TCTTCCTCTCTCTCTTTCTCTCTCTCTCTCATTCTCTGTC
TCTTGTTTTGGGGCAGGGGTGCTTGTGAGGCATGCTGACA
TGGATATTTTCCCTCTTCTGCTGCAGTGGTGTTGGGTGCT
TGGCTCGCTGAGGAGACTGACATACAGAGCCTTTGGTTTT
CCAGCAGTCATTAGTGGACTAAATGGTAACGTCCAGCAAT
TGTGCTATTGATTATCGCCAGATTCGAAGCTAAAATGTTC
CTGTTTCACATCAGCATGCTTTCTTCCCCCCTTTTTTTGT
TGCTCAGCTTTCTCTTCTCTTTTACAGATCCATGCTAATT
ATTTGTTAGATGCAGATGCGTCTGCGTAAAGTATGTGAAC
ATTTGGAGGTTCATCTTTTGTGTTGTCTTTTGAAACTGGA
ATTATAAGGCATCACACTAATTAGAAGGCAGTGAGTGGCT
TAAAGGGATAGTTGACACAAAAGATGTTTTGAAGAAAGCT
GAAAACATGTAACCAATAACATTCCATAGTAGGAACAACA
AATACTATGGAAGTCAGTGGCTACCAGTGTCCACCATTTT
TTGGAACTCAAAAAGGTTTTCAACAAGTAAATGATGATTG
AGTTTTGCGTGAACTATCCCTTTATATATCTACAATATGA
TCAAACTCATTTTGCAGCCAAACTGTCATCTTCTTTTTTT
CATATGTTGTTAAAGGGATGTTTCACTACACCTCTAAATA
GTCATCATTTGTTCATCCTCAAAGCGGTGATGCTTTCTTT
TGTGGAACATGAAAAGATAAACTACATTTTTCAATATCTT
TTTTTTTTTTGTCCATACAGTGCAAACCAACAGTCTCCAA
TGTTGAACTTTGCTTGGATCACTTTGGTTTTAATTAAATG
GACAAAAATAATTAAAAAATAATAACTTTGTTTCCAAAAT
AAGTTAAATCCAGTCTGGAATGATGTGAGGATGAGTAAGC
AATGACAATATTAAATGTTGGTGAGTAGTCCTTTTGCAAA
AGTGCTCATGTCCATCATCACTAACTTGATAAGCACTAAA
ATCTTAATTTAGTTGAGCCAAGACTGCAAAGATCAGCGGC
TTTTATATGTTATTAATTATAATTCTGATTATTATATGTT
TGTAAGAATGATCTCATTTTAAAATCATCCCTTGCTTGAG
TTTTGTTGGTCTTCAAGATGAAGATTTTTGACATCATTGA
CGCCTGAATACTTTTGTTGTGAATTGGATTTCATGTAATG
TCAGAAATAGTGGGTTGTGGTATAGTGTTGTGTAGCATGT
TCATTTGTGGCGGCCCTGTGGATTTTTCAAGTTGTTGGGT
TCATACTGAACAGGGTTTCATACAATTTCAGATTTCATTT
TCCAGGGCTTTGACAAGCAATGAGATTGGATTGCTTTCGG
ATGGTCGTGTATATATAGTGTAGTGACTAACAAATGCCTT
TCTGACTTTAGTTGAACTTGTTTATTTGGTCATTACTGGA
ATGAGTTTATTTCAAAGGGAATTCAGTAACAATAAGGGCT
GCTGTATTATTAGGCACTGTCAAACATTTAGCATTATGAT
GAGCGGGTGTTTATACTGAGAAGTGTCACCACTAGGGGAA
GCCAGTGATCTTCAGGAACTACAAGAGTAGGCAACAAACA
GTTAAAAAACGTTGTGGTTTAGCTTTTCTTGGAAGTTGTC
AAATCTGTATAAGTTGCAGTCATATGCCAATAATAGCAAT
GCATTGCATCAAATCATTTCGAATAGCGTCTGTCAGTACT
ATCTCAGGAAAAGAGACCTGCGTGTTAACTTGAATGGCCT
GTTTTTTTCTTTCTTAGAAAACAATATAAACTTGACTGAA
ATTTGAGTCGGGTGTCAGTTTGTGTTGATTGTGTGAATCT
GTCACACGACATGTTGATTTTTCATCATTTGCAGACTGGT
CGATTAAAGAGATGAGCACTGATTTAATACAGTTAGTCCG
ATTGTTGATGCTACATCCTGTTGCTTTTGCCATTTTCCCT
TTTAAAGGGATAGTTCACCCAAAATTCTGTCATTTACTTG
TGCTCCTAATTGAGTTTGTTTCTTCTTTTGAATACACAAA
TGAAGAAACACTGAGGAATGTTGAAATAAAACAGCCATTG
AATTCCATAATAGTTTTTTTTTTTACTATGGATTTCTGTG
ACTGCTTTCTCCTCTCAACATTCTTCAGAATATCTTGTTT
TGTGTTCAACTGAAGATAGAAATTCCTAAAGGTTTAGAAC
CACTTAAATGTGAGCAAATGATGAGGAAACGTCAATTTTT
GGGTGAGCTATCCCTTAAGTTTGACTTTATCCATGGTTTT
GCTTTAGAGTGTGAATATGACTGTCTTAAAGCGATGTGTT
CCCTGTGGTTGTTAAATGGAGAGAGGACAGACTTTGACTG
CCCTGGAATAAACCCACTCTGTGAATGTCACTTTTTTATG
TCAGCGTAATTTAAGCTCCTAATTTTAAAACATTTATATG
CAAAATTTATAAAATTTTGACAATGTTCAATTCTGTGAAA
TAAAACCTATTTTGATACCATGAAAA

erlin1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA erlin1-201 3706
erlin1-202 (1)    Ensembl 967
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
erlin1-201 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000029639 (1),  Ensembl_Trans:ENSDART00000003922 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC091924 (1) 2000 nt
GenBank:EE716004 (1) 955 nt
GenBank:EH602155 (1) 917 nt
GenBank:DV599115 (1) 804 nt
GenBank:CK026039 (1) 774 nt
GenBank:DR718476 (1) 763 nt
GenBank:CT614117 (1) 667 nt
GenBank:CK691468 (1) 623 nt
GenBank:CT620366 (1) 588 nt
GenBank:EB965513 (1) 432 nt
CITATIONS (2)