ZFIN ID: ZDB-TSCRIPT-090929-11855
Transcript Name: commd9-203
Previous Names: commd9-003, si:ch211-15d5.2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029461 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029461|OTTDARG00000022764|ZDB-GENE-070424-139 commd9|OTTDARP00000040040 CH211-15D5.2-003 LG_ CR626962.9 Danio rerio protein_coding KNOWN, 729 bp
ATCAAACATGGCTTTCATGACACAAGATCAGTTCACTGCT
TTGCAACTGCTGTTAAAGGCTCCGTCTAAAGATGCTGTTC
GGCAGATCTGCACAGAGAGTTTCCCAGCCGGAGCCTTCAA
GAGTCAGTCTGTAGTGGAGAAAACTGCCAATGCTCTCTCT
GTCTCTCACAATGAAGCGGTCCAGCTGCTGACTGCATTTC
ACACACTTTCACATCACATTGTGTATCATAACTTAACATC
TCCGGAGCAGATCCTGTCAATTTTCCCAGAATCATTCCAC
TCAAACCTAAAGAACCTGATCACCAAAATTCTCTTGGAGA
ACAGTGTGAAATGGAGAAATGAAGCTTTGGCAAATCAAAA
TGTGTTTTAATAGTTTCGCTGCCAAAGCTGGTGGATATGG
AGTGGCGAGTGGACATGAAAACTGCATCAGACTCCCTGAG
TCGTATGGCTGTGCCAACCTGTCTGTTACAAATGAAACTC
CAGGATACTCCGTGCATTAGTAGTGGTCCCAGTGAGTCTA
CAGTAACAATGGAGCTGAGCAAAGAAACGCTGGACACTAT
GATAGACGGTTTGGGTCGCATCAGGGATCAGCTCTCTGCA
GTTGCAAGGAAGTAGAGCAGATGAGAGATGCTGCACCTTC
GCCTGTCTGTGGACATTCAGATGGAGAATGGAAGAATCCC
CCAAATGTAAAAAGAAAAGACATTAAATATAAACTTGGAT
TCATTTCGT

commd9 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript commd9-203 729
mRNA commd9-201 (1)    Ensembl 910
ncRNA commd9-002 (1)    Ensembl 769
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
commd9-203 Contained in:
[BAC] CH211-15D5 (1)

Genome Resources: Vega_Trans:OTTDART00000029461 (1),  Ensembl_Trans:ENSDART00000148003 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH453168 (1) 754 nt
GenBank:EH478943 (1) 738 nt
CITATIONS (2)