ZFIN ID: ZDB-TSCRIPT-090929-11853
Transcript Name: commd9-201
Previous Names: commd9-001, si:ch211-15d5.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029459 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029459|OTTDARG00000022764|ZDB-GENE-070424-139 commd9|OTTDARP00000024051 CH211-15D5.2-001 LG_ CR626962.9 Danio rerio protein_coding KNOWN, 910 bp
ACCAGATCAAATCGTGAATTCACGTGACTTTCAGTATCAA
ACATGGCTTTCATGACACAAGATCAGTTCACTGCTTTGCA
ACTGCTGTTAAAGGCTCCGTCTAAAGATGCTGTTCGGCAG
ATCTGCACAGAGAGTTTCCCAGCCGGAGCCTTCAAGAGTC
AGTCTGTAGTGGAGAAAACTGCCAATGCTCTCTCTGTCTC
TCACAATGAAGCGGTCCAGCTGCTGACTGCATTTCACACA
CTTTCACATCACATTGTGTATCATAACTTAACATCTCCGG
AGCAGATCCTGTCAATTTTCCCAGAATCATTCCACTCAAA
CCTAAAGAACCTGATCACCAAAATTCTCTTGGAGAACAGT
GTGAAATGGAGAAATGAAGCTTTGGCAAATCAAATTTCGC
TGCCAAAGCTGGTGGATATGGAGTGGCGAGTGGACATGAA
AACTGCATCAGACTCCCTGAGTCGTATGGCTGTGCCAACC
TGTCTGTTACAAATGAAACTCCAGGATACTCCGTGCATTA
GTAGTGGTCCCAGTGAGTCTACAGTAACAATGGAGCTGAG
CAAAGAAACGCTGGACACTATGATAGACGGTTTGGGTCGC
ATCAGGGATCAGCTCTCTGCAGTTGCAAGGAAGTAGAGCA
GATGAGAGATGCTGCACCTTCGCCTGTCTGTGGACATTCA
GATGGAGAATGGAAGAATCCCCCAAATGTAAAAAGAAAAG
ACATTAAATATAAACTTGGATTCATTTCGTGAAAAAGTTT
GCTCTTGTTTTCTGTTTTTTATTTCATGTTTATAACCTAT
TTGACAGTTGTTTCTTATTAACGTTTCCATTGCAGAAAAT
CAGTTTTATTGTGATAAATTTTCACAGCAACAAACTCAAC
AAATGTCTAATAAATTAAATTTTTTCACTA

commd9 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript commd9-203 (1)    Ensembl 729
mRNA commd9-201 910
ncRNA commd9-002 (1)    Ensembl 769
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
commd9-201 Contained in:
[BAC] CH211-15D5 (1)

Genome Resources: Vega_Trans:OTTDART00000029459 (1),  Ensembl_Trans:ENSDART00000092925 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC107840 (1) 903 nt
GenBank:EH581365 (1) 893 nt
GenBank:BC117618 (1) 749 nt
CITATIONS (2)