ZFIN ID: ZDB-TSCRIPT-090929-11854
Transcript Name: commd9-002
Previous Name: si:ch211-15d5.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029460 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029460|OTTDARG00000022764|ZDB-GENE-070424-139 commd9|no_translation CH211-15D5.2-002 LG_ CR626962.9 Danio rerio protein_coding KNOWN, 769 bp
AAGGTAGTGTAATATCACATACTGTTTAGTATATCGCTGA
ATTACTTGGCTTGATTGAGCTCGTGTATTCTGCCATCTTT
TACTTTGATTCAGGCTCCGTCTAAAGATGCTGTTCGGCAG
ATCTGCACAGAGAGTTTCCCAGCCGGAGCCTTCAAGAGTC
AGTCTGTAGTGGAGAAAACTGCCAATGCTCTCTCTGTCTC
TCACAATGAAGCGGTCCAGCTGCTGACTGCATTTCACACA
CTTTCACATCACATTGTGTATCATAACTTAACATCTCCGG
AGCAGATCCTGTCAATTTTCCCAGAATCATTCCACTCAAA
CCTAAAGAACCTGATCACCAAAATTCTCTTGGAGAACAGT
GTGAAATGGAGAAATGAAGCTTTGGCAAATCAAATTTCGC
TGCCAAAGCTGGTGGATATGGAGTGGCGAGTGGACATGAA
AACTGCATCAGACTCCCTGAGTCGTATGGCTGTGCCAACC
TGTCTGTTACAAATGAAACTCCAGGATACTCCGTGCATTA
GTAGTGGTCCCAGTGAGTCTACAGTAACAATGGAGCTGAG
CAAAGAAACGCTGGACACTATGATAGACGGTTTGGGTCGC
ATCAGGGATCAGCTCTCTGCAGTTGCAAGGAAGTAGAGCA
GATGAGAGATGCTGCACCTTCGCCTGTCTGTGGACATTCA
GATGGAGAATGGAAGAATCCCCCAAATGTAAAAAGAAAAG
ACATTAAATATAAACTTGGATTCATTTCGTGAAAAAGTTT
GCTCTTGTT

commd9 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript commd9-203 (1)    Ensembl 729
mRNA commd9-201 (1)    Ensembl 910
ncRNA commd9-002 769
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
commd9-002 Contained in:
[BAC] CH211-15D5 (1)

Genome Resources: Vega_Trans:OTTDART00000029460 (1),  Ensembl_Trans:ENSDART00000143542 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH549837 (1) 812 nt
CITATIONS (2)